Description :
Non Conding Region
Location :
Scaffold_1:48723- 48929
Sequence
206 bases(100 bases per row)
GCGGTTGTATCTTCCTTTTTTTATTGTCTGGTTGGGTTTTATCAGTGTCAATGCCATGGTCGTCCCCATTACTGCTTGCTATCTCGGACTGTGTCGGTTT
TCTGTGGACTACGGCATCTAATTTCGTGGCGGAGGCAACCGAAGCGACCCAAACTGCCCAACACTTCACCTGCTCTCTTTTGCCTGCGGCGTCCACACCG
TGACGA