Description :
Non Conding Region
Location :
contig_1:48621- 49019
Sequence
398 bases(100 bases per row)
GCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGT
ATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATTCG
CACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCT
AAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCA