Description :
Non Conding Region
Location :
Scaffold_1:48618- 49239
Sequence
621 bases(100 bases per row)
GCTTCACTAcGGCCTGTTGCAATGTGGCGTCCACAGTGAAaTCACCGAAGTTTCCGTGGACCTGGGACCTCTTGTTGGCGGATTGCGCCGTGCTGTGGAC
GTAGGTCTATCCTGGGCCGCGACGAGGATTGTGGTTGCCACGTGGGGAGGGATCCGCCTAAGGAACGCCACTCCTGCGAGAGGGTTTGTGCGCGATCGGT
GCCGACGCTGGTCTAAAAaGGCAGCCACTCTGTAGACCGCACCGCGTCAACaCCAAACGCCCTGGTGACTCGCGTGGCTTCGTTCCACACATTTTTGAGT
CGGTAGCCCGTCTCTTGTGCGCCGAGAACTTTCGAAAACGGGAaTCAGCCGCTGGATTTGAGGGGTCGAGGACTTTGGATTGGCTGAAATGGACTTCCAA
ATGCCATCTTTTGAGTTGGAGGGGGTAGGGATGAAGACTGGGTTCAGACGGGTTTGGGTCTCACTCTACGGTACACTTGATTTCTGCTTGAACCCATGCC
CAGTTGCGAGTGATCAACACTCCCTCTACCAAAAGGCATGGGTATGCATTATGAGAGGTATGATGGTTGTCACCAGGATGGACACACTTGATGGTGACCA
AGAGCTCACCACCAGGCAACA