Description :
Non Conding Region
Location :
Scaffold_1:48610- 48842
Sequence
232 bases(100 bases per row)
GTCGTCAGTTGGCGGTTGATGTTGAAGCGCGCGGCACAATGCCCAGGCCCGTAAATAGTGACGAAGTGTCAGTTTACAATAACCTTCTATATCATATATC
CTTCTTATTCAGCGTCGCAATAACCCGCTTGGACTGCAGCATTTGATATATGGCTGAGCGTCCTCAAACCGGCACAGTCGACTGTGGTGGTGGAGTCGGG
AAAGCGCGCACTTTTTCTTCGGCGTGGCGCGA