Description :
Non Conding Region
Location :
scaffold_1:48524- 48826
Sequence
302 bases(100 bases per row)
CCAGCGCAAGACGAGAACAAGTCTACGAGCATGCGGAACAGTTTCAAGGAGACGAAGAGTACAGGGTCGAATAGAAGCAAGCTCACTCGCTGGACATGAA
TTTTAACTACTTTTACTAAGCAGGATAAAGATTGTGTTGCCTGCAATGTGACCTCTTTGTCGGTAAGAATGTAAATTAACTGTCAAGTCTTGGTTTCAGC
GGTTGTTCAAAATGGACATTCCTCTCTATGTAAATTCCCATCGCTAGACTTTTAATGCACTGCTGCTACAGTAGAGCTGCATGCTATTGCCGCATAGCTA
TT