Description :
Non Conding Region
Location :
Scaffold_1:48447- 48562
Sequence
115 bases(100 bases per row)
GCTGACGTACGAACCAGCGAAAAATGGGCAAACGTGCTTATGTGAAAAGAAAATGGAACGGACTAAAACAAAATAGTCACACTATATCCATCACTTTCCA
ACAACCTGCATCAAT