Description :
Non Conding Region
Location :
Scaffold_1:48328- 49093
Sequence
765 bases(100 bases per row)
GCAATGAAAGTGACGCGATGCAGCGTGGCCACCCTTTCCTCTGCAGAGGCGCTGCCACGCGCTGGAGAGGAGAGCGCAGAGAGTGTTGTTTCGTGACAGT
CTCTCATCAACTTGAGAGCAGAGCCTCATGAAACAAGCCTCCGCTACAGAGGGGCCAAGGTCGCAGTGCAAGTAGACACCGCTGCTTCGTGTCGAGTCTG
GGCGAGTGCGTCGCCTCCTGCCTTTCCCATGCGGACTACAGTGCTTGGTTGGTTGACGCGACCGAAACGAAGGCTGTGGCGGGACTCGAACCCGGCTCGC
TGACGTTCTGCCTTTTGGTGGCAAGAAAAAGGGAGCGGGTTCTGTCGCACTGCACGTTTGCTCTCGACACCTTACCTGCGTTCGCAGAGTGTCGTTGACG
CAATGCTTGTGCCATCGCCACAGGTATTACATCGGAGCTCACTGCTGCTTGGGATGAACTGCTTTTCGATGGAAGATTTCAAAAATGAAAAGTTGAAATT
CCTCCCGAGCAAATATATATGCGCGGAATAGGAGGCTGAAGGAGACGCTGTCACCGAGAACGGCGCCCGACGCACTGACGCTTCGTGATGAGCATCGAGC
GCATCAAGCACGGAAAGCAGTGCAGTACCCGAGAAAGCTCGGCACCGGGAGCGCGCGCCCCTTCGCACGACCGTCGACGCTCATGGTCGACGCTAACCTT
CGCCGGAACACTGGCACCACCTGTTGGGTCGAACATCGAGCAGAAGACTTGAGAAACGGATCTCG