Description :
Non Conding Region
Location :
Scaffold_1:48210- 48336
Sequence
126 bases(100 bases per row)
AAATGAACCGTCGAGAAGACATCCCCACACACAAATCTTTCCTCCAACGGACTCACCAATTCTCTGGGCAAGTCAAACAAACTCACCTTTTGGCTAGTAC
TACTAATAGTAGTATTGATTGACAAC