Description :
Non Conding Region
Location :
Scaffold_1:48032- 50536
Sequence
2504 bases(100 bases per row)
GTCCGGTCCGTCGTCGTGGCACCACGTCGACCACGCGTCTCGTCAATTGGCTCTATTGATCCGGATTCTGAAACCATATCCGTGATGGTGGGAGACGCCA
GGGAGTGTCCAGCACGCTTGTACGAACTCGAGGTCGCACGTCCTCCGTGCGACGCCGATGTTATCACCAACCTTCCCGGCCTGTCGTGGAAACATTTCCT
CCGCGACCTGAAACACGGCGAGATCGACCAAGTATGCATGCTCGTGGCTGAGGACGCCGCGACCATCGCGGCTGTCAACGCCGGTCCTGCGGACTCCGCG
TCCGACCCGCGACATCGTCTGAAAGGGGCCGAACCTAAGAGCGCTCGCGAAGTACGGTACGCGGCTCAGTCGTTGCCGGCTCTCCAAGCGTCCGGCAACC
CTGCGGCTTCCCTAGTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTACTATACCAAGCACTAAATATACGTTAACGTTTCTGGCTCAAGAACGTCGAACACAATCTTTATACCAGCTTTCTTTATT
AGAGAGGACCGCATGAAGCGTATTAACAAGTCTCACATTGCAGAGAATCCGCCTGAATAGTCTGCCTCACTGTGAGCTGGAAGCCATAAGCTAATCTTAC
GAATTGGTATGTACTCCAACTTATTACTAGTACTGGGATCATACTATTTCGCATCAACTAGGTATGTAACGGGGCTTAGCGCGTCCGTTACCTTGCGTAC
ACAGTTGCGAGGAAGCTGGTAGATATAACTCTGATTAAAGAAAGTTACCGGCGTGGTCTTGCGACCACGCCAACCAGTGAGGTGGAACTAGACTCTAATT
GGCTACTGCGGTGGGCGCAGTAGCACCGTGTGACGGAAGCCCGTCACACCATCCCCCACTTTAGAAAGGAGACACGCGGCATTCTTCGTTTGAGATGACA
GCGA