Description :
Non Conding Region
Location :
Scaffold_1:47992- 55948
Sequence
7956 bases(100 bases per row)
AAAGCTGGAATGAATGAAGTGAGGGGGATCTTGGCTCTCGAGCCTGGCTATATGCGTCTTTGTATGGCGCCACGCATGCGCGGAAATCTCAGTTGGATTT
CGGCTCTGGCCAATGAGCGCACGCAGCGGCGCATGTGGGTTCACTTCTTAGGCATGGAGCACGGTATAGCTCGACCCGCTGTTGCCTGTTGATACGGATG
CTACTCGATGCTGGCTGAGACCATATTGCTGAGACGGACTGCGGAGGCGCCTTTTACCGTCGCGGTTGTGATATCCGAGCAAGTGCTGGCAGCAATAATG
GAGATCGGCGCCGCCACCGCAAGAGTTAATCGTTGCGGCCTCGGCATCGCCGGATTACTGTGCTGTGCAGACCTTGCTGCCCACGCGCTCACTCTGGTCT
ATGCGCGTAAATCACCGTCGACCGATGCATTTGCTTTCTTGCTCGAGGCCAAGGCTTCGTTACTCGACTCGAGTAATGGGGCAGTCGAGCTCGACTGTAC
ACGGGCAACACCATGTTACATGTGTATTCGCTAGGAGACGTGTTCGCTCTAGTGGCGAAGCATTTCATCTTCCCTCCTGGGATGGTTCGCAGTGATGATA
CTTCGGCACTGTACCATGTTCGAGAGGGGTATCCTGACATATTCAACAGCCACCTCCGCCCGCTTTGCTGATTTCCAAGAAAAATGATAAAAGTAAGCGC
TTTGATATCAGGTCGCCTGGATTGTGGTGTGTGAGTCTTGTATGCATGCACTGTCATAGCCCTCGACTGGGAAGGCGTGCTTACTTCAGCAACGAGGACG
GATGCGATGGTGTTGAGTCGAATCGCAGGAGTTAGTTCACAGCATTAGTGTCGCTGGGTAAGTTTATAACGGGAAAGTAACGTGTGCCAAAAGTGTTAAA
ATTGCTATAAAAAAACTTAACACAGATTATTTACTGGAAGGTCACTTCAAATTATGCTGGTTTCATCAAAATTAAATCCGCAAGTGGCCCAAGCCACCCC
ATACTTTCTCGGAAGCATCTAAAACATGCTCTGGCACGTTTTCACGCTGTGGTTGCTGCTAGTTCAGGCGTCATTAGCGCTCCTATCTTCCTACCCATGA
GACCACCCCTTAGCTGTCCATTTTCGATACTCAAGCTCAGTTGTTTGAAGGGTCGAGCATGCGCTATTTTTAGAATCGACTCGATAGCAGCATTATCAGT
GAAGTGGTTGCACATCATAGCATGCTCTGCTTTTAATAATGCTCTTCCTCCTAAGTGCAATTGCGTATCATTTAGAGCACACGCAGCGCTTTCCAACGAT
GTTTTTATCCCCATGTGGAAGGACCTAACGGATTTAAAGACTTTTGACCTAGCATAGCAAAAGGCGGCTTTTCGTGACCTTCCAGTAAATAATCTGTGTT
AAGAGAGGATGCTAAAGAGTTGTTCCTCGGGGCTAATGAAGTAGTATCAAACCCATCTACAATTTCGGTTTGCTGAATATCAAGATGGCCGTGTTGAACG
AAGCTCTGCAGGGTTTTTAGAAGCTGCCTTACGAACGCAAAACTACTGTACCAGATCGCAAACTTACACATATTCATAGTGAGCTGCCGACAGGTGGCTA
AATGGTTTAACATCTTCTTGCCATACCAACTAAGTGACTTGTACTATCGGAGGAGGAGGGGGGGGGTCGCACTAGTCTATTTAACTTACGGTTTACAAAA
TTGTCTGGAAAGTCCCAAGCCAGGTTAGCAGCGGCGAAGCTGATGGTGGCCCCGGTACGTGACTCGCCTCATAAAGAGGTGCCTCTTTTGGGGTCTGCTG
GAAAAGATCTAAGCAGATCAATAAACGCGTTCCTTGTTCCATGGCCCGCGGATTTCGCCATTCTCGTTTCGCTAGCGCGCGGAGTTGACGTAGTCCGGCT
GCTTGAAAAGCAGCAGCACTGCTTTCGGTTGTGACTTGATTACCTTGATGCACCACTCGATTCCTCTGGAGCCTCAATACTGTTATGCAGACTCCACCAA
TTCGTTTCCGCTCTCGCTCGTACTCTGGTGCTTCGTCTTGAAATGCATAACTGAGTCGATGGCTAAGTTTTGACGATAATGAAGGCGGCGATCGGGATGC
ACAACTTGCCATGAAGTGCTGGAATTGCGAGACCTGACATTGCCGGACCGTCCGGTGTACTTGTACTATCGACTTCGGAGCTGGAGTCGATTAAAAAAAT
GCATAGCCCTATGCATTTTTTTTTGCCTAAGCATAGGGGTCTGCTCGCTACAGCACACCAACTTGTTATTTCCGACCGTGGTTGTTCCTCGCTGCAATCA
AGGTACGCCGTAGTGAACGTGTTTTTAAGCACGGAGTCGCTGGAAGCACAGAGTGCATCAATCCTTGTCGAAGGCGCTAGGACTTCGTGATCTTGGTGGT
AGATAGAAAATTCCGAACTAACCAGTGCAGGTACTACCAGCAAGATGAACGGGTTATCACGACAGTCGAATCGTGGTCAAGCTCGATGATGATGTGGTAT
ATTGGACTTAGTCTGAATCCTAACAACCCTATAGCCGATGTTTTACCTTCGGCCGCCCTCCCTCAGTCGGCAGCTTACTCTTCAGTGCTGTAAACTTCCA
TAGCCCACTTCGCGTAGGTCCGTCGTGCCAGTTGCGCTATTCGATGACAGTTTGCACTGAAAGCCTCGTTTATTATGTTTCAGTCGCCAACTGTGCTAAG
CTGCGGGAGCTTGCGTTGGTGGTTCTGGGCAGCGAGGTCCATGACGCAACCCGGACTTTGTCTGCTCGCTGCCGGCACTTGTAAAACCAGATTCGTAGCC
TTGTGGACTTCGGGGGCGTTCCGGCGGCCATCGCCCTTATCAGCAGGGCATTGTCTCCCACAATGTGAATCCGTTTCTGCTTCTGTCCGTTCGCCTGGCT
GAGGACATGAAAAACGTCACAAAACCCGCAATATTCAACGTGCATTTGGGAGATGGGATCACAATGCTTGCGCCCCAGAGTACTTCTGCGTGTTGATCGT
GACCGCCTTGGCAAATCAAGACACCGCCTGCTCCGTTTCTTCTTGGGATTCCGCTCGTGCAAATTGTGGCCAAGCTCGCTCAAAGCATAGCTTTATCTCG
AATTTCGAGACTCGAAACGTCAAAGCATCCGTGCGTACTAGCCCAGCGTTATGTCGCCATTAGCGCATTGATATCAATAATTCTGAATAGAAATGCAGAC
TTGTTCTGTTTCTGCTATTTGATTCAGTGTAGCAGAAAAATATGAAGTAGCTAATAAGGTTAGTGAATTCCGCAAACATGTTCGTGATTTTTACAACACA
CAAACTCACTGTAGGTGCTGACTGCAAACGCGTTTGTATGTTTTGCTGCTCAGTCACGAGCATGACAAATTACTGGCTCCTCAAGAGGACTGTTACCCGT
TGCCGTATCCATATTCCACGTACGCACACGGCGCAGCCAGTCCTACATAGCTTGAGGACTTTATGGTTAAGAAGAAGCACTGCGTAAAAGTCAGCTTGCG
GTAAATGAGAAAGAGGTTCAACGTTTTGTAGTTGAAACCTTCAAGGGAATTATAAAAAAAACTATCTAACTCCACAAACATATTAGCCAGATTCACTACA
CTCTAACAAACAGTTTGCACACGCTAGTGTTAGCTACACAGTGTTTGTGCGAACACTACATATATAAGGCTTTCAAGTCGACATTTAACACCAACCCTCC
CTACTTAAAAGGAATATAGGTCAGGTGTATATACAGCGGAAATGTATGGAATACTTTGGAATGCTATGAAAATTGGTACATACATACTTTACTATGTTAT
CTTTCATGTGGCAAAATTTCAAGAGTGCACCTTTAGTTCTGGCGAAGATATAGCTCCTTGTAACTAGCTTCATCGGCCGCTCGACGCATTCTCGAGCTCG
AGTGGCCGAAGCAAGGTATCTTGACCCACTAACCTAACCCTGCGCGAATTATATCACCACAGACGTGGAAGTACAGAAGGTGGCGCCTTAGAGGGACGGT
ATATATTGTAATAACCGGTCAAAATGCCCACCTGTAGCAACCGCTTATTAGGTCTCAATCACCTAATTAATCAGAGTATAAATCAGGGTATAAATCGATT
GTGATCCATATGCATCGCTGGGCTGCACGATTGTCCAGTAAAAGGTGGGCATTCCGCTCGAAACACGTCTATATCGACTGGTTTCACATAAATCGATCGT
ACCCATTCACATATGCATCGCAGGGACGCGATCGATTTGTAAATCGATCGAGCTAAATCAGGGTGCTAATCAATCGATTTACAATACAAATTCTTATATT
AAAAAAGTACAGATCTCTGTTACCAGCATACGAATTGCATAAGTTAGTCGAACTCGGGAGGGATGACCTTCCTTCAAATCTGCTTCAACTTGTCTCACGA
GTAAGGATTGTATGATGCTCGGTGAAGCAATTCCGCCGCAATGACAAGCAAAATGGCATATTGCAGGCACCGCACACTACCGTTGTCTGCCGCAAGTGTC
CTCGACACCTGCACAACTCGCACAACACCCTACGCGCTTGAAAGATGGGCAGGTGGAACTGTCCATCCATGACTTGCTGCTTCTTCGGACTGGCTGTGAC
TAGCTGCCAAGCTAATTCCTGACGAAGTGCGCGTTGACTTTGCGCATTTCGGTTCGTTCGAGTACAAATATTTTGGTGCAGAATGTAAGAATTGATGATA
GTCGTGTCTAAAAGCCGAGTCCATTGCCACATCTGGGCTATTGAGGACGGCAGAATACGTGCAGGCCGTGGCGCGGGACGAGCGGCACGTACTCCTCGTT
GCTTGCAGTAGCGCTCGGTGTGGTGCTTGCTTTCATCGGTAGGCTTTGCACTCAGTGTCAACCACCCTGTGCCCTTTTTCGTGTGACCAAAATAATGGCC
CTTTTACCGGGGCAAGGGCTCCTATTTTGGTCGTTTGAGGCCAGTATGTGAGTATTTTTAGCGTTCTTTTTTTGCTAGAATCGTCTGTTTCCATGCAATC
AACTGATGTCTGCGGTTTTCGCAAAAACACGTGCTTTCGCCCAGAAAAAATACCAAAATGCAAATTTGCATTCCCCGGGCAGAGCTTTTCCCAAAACCAG
TACCAGTACCAGTCCCAAAACCAGCAGCAGTAGTAATCCGAAGTAGAGTGGACCACTTGCATTTGGGGCAGCGCGGTGTTGATCGAGAATCATGAGTGCG
GCAACTGCGCCGTGTGCACGACGGACTACATGCTACTGCGAAGGAGATGACCGGATCTCTTAGTACTGCGGTGCAGGTACGCGTAGTCGTAGCGTGCGAG
GCTGGTGCAAAGATACGGGGGTTCATCGTGCCGTCGACTGGCGTGTACCGCCGATGCCAAACGAGAAGGCGGTAAGCTTGGCGACTACATGTAGCGTTGC
ATGAGTTTAATGCCTGCCTCGTTGCTAACATCAGCGAGCTCTGCGTGTACCATGTACTGTATCTAGACTCCAGAGACCAAGATAGCGATTCAGTGTAGCG
GCGTGCTCGGCTGAAGGTGGGAATCCACCAAGGTGAAGACTCCAGTGGTCATGACAGCGATGCTACAGTGCAGAGTGAGGTGACTCTGCGCGTCCACGCT
CAGCTGTGGATAGAAGAGATCGATGCGGTGACTCTCTCGTAGGAACTGAACGAAACTTGTCTTCGGAAGCACCGAAGCTGCAAAAGCAGGAAGTTTGTCT
TTGGAAGCGTTAAAGTTGACGCGAGTGTTGCCTAGTAGAGTTGCGTTGAGGTACTTGTGCCGACGGTGGTCTTGGGGTGTAGAGAGCAGGAGCTGCAGCA
GGTCGAGGGAGGGTGAAGCTTTTGCTCCAGAGGGGGGAAGCTGATGTGAAGGCCATGGTTGGAAGCATCGACCCCAACGATAAAGATAGCATCTCGTCCT
CGCGTACTTGTGGCCCAAATGCAAGTGGTCCACTCTACTTCGGATTACTACTGCTGCTGGTTTTGGGACTGGTACTGGTCCTGGGATTAGGACCCCAGAC
TGGTACTGGTTTTGGGAAAAGCTCTCCCCGGGCACGAAGAGATAGGCTGGGTGTTGTAGAGATGTTTAGAGTGTTTAGGGGAGGTTCCCCTTGCTTAGGA
CTTGCGGCCACCTACGCGGGGGTGTCGTGTTTGGGCGAAGTTCTTACGAATAATGCTGTCCTTAGCACAGTTCACTTAGCGCCATGCGTCTAGATAGATT
CTTAGCTTTCTAGAGGTATATTTGTATTATGATTTGGCGAATAACCGCACTTATGCCTGCCCAAGTACACCCGGCCAAACGGCAGTTCTGGTCCTTCTCT
ATCCAGAGGTCCTGTGTTAAGAGCATCTCGACAGTGTGGTTGGTACAGGACGACGCGAAGATCTGCTTCGTATTGGCTCGACACCTGGACATTACAGATC
CGCTTCCTAAATTGAAACGCATGGCGGGACCCCGGTGCTCTCACCACAAACCGGTAACCATATCACACTCCTAAGTACTAATGTATTATATATGTGGGTA
ATGAATGCACGGACTAGGATGTACTTGGCCTAACTACTAGCTGGTTTTGCGCCGAAAAACTGCAGTATGGAAGGCTGGTTGCTACGGGGGTGAGAGGGGC
TTTTTCGGGGTCGACCTGGTTTACGCTTCTTTTGTTTTTGCTTGTGAGCTCCTTGATCATCAGTGTCGGGTCCACCCGGAGTCTTACCATCTTGAACAGG
AGCATTGAGAATGGCTTCAGGTACACTCGGGTGTGGAGAAGTGCTGAATAAGACTTGTTCTCCGAGAAAGGCGGCAGGGCCGATCGACTGGAGGCGTGGG
AGATCGGCGATTGAGAGACAGGCAGCAAGGATCTACGGATCAGAAGGAGTTCTTCGGGAGGTCTCAGGTGGTCCGATGACGCCGGCGCGTAAGGCAGGAC
ATGTGGCAAGCCGGATTGTGGGTGATCGTGCCCGAACCGCGGCGTGATTCGGGGCCGACTCAAATCCAGATCGACGACAGAACCTGCGGAACTGGGATGG
CCGAGGACAGAAGGTGATAGATCGCGCGGTTATAGGCCGCCTCCTTTCGATCCTCCCGCTTCTTCCGCTTGCGTGGAGGAACAGTCGATTGAGAGCCTCC
CGTGGCTCGAGGTGGCGTGCTTGGTGCTGATGCCGACGGACGCAAAGTGGTTTCGACTGGTAGAGCCAGGGGGATTTGGCCTGCAGCGACAAAAATAAAT
AATTCCCGAAGTGAGCGGTTTTTATGCGGGACCCCGGGGTCCCGCCATCCGTTTCAATTGTCGAATACATGTAGCATAATGCTTCCACTTTGTCAAACAA
AAGCTCAGTTGGTCCATGCTCATAACTGGCCCCCTCCTTTGCTTTCTCCCTGAGAATTAAATCTTTGTTGCTCCTATTTAATTATGTCACTTCGCAATTT
ACTCTTGCAATTGGCACGTCTTTCCTAGGTTTCCGTACCGATACGAGCTACTTCATCATGACATTGTTTATTTCGTGCGTCGATCGAATCAAAAAGCAAT
TTAGCGTCTCTTTGCAGGCGCCGTCCCAGGTGGTTGTCCGGTTCAGGCGTCCCCGGGCTAGTCCCGGCTGTATATTTTAATGTACCTCGCACAGGAAGTA
CAACAAGCTCTCAAGATTTGCGCGCTACTTCTGCAAACATATTGATTTATATGAGTGTACAGCGAGACCTACTGCGACAAGTGGCACGTTGCGGAAATAC
CTCCACCGTATTCTTGAGCTAAGCTTGTAGTAAGTCAGTACATACTCATTTATGTTCAGACCGCGTGAATTTTGTTGATTCTTAAACATCATAAGTACCA
CTGTGGCGAATAGGCCGTATTCGCTTTCAATCAGTGCTAGAAATTCTCAAAACTGGAGTAATGACAGCTTTCAAGGTAAACTTCAGAGGCTAGAACATGA
CGCTACCTTAAACTTGTATCTCGATCGATAGAGGTTGCTGCAGCGGTATCTGCTCT