Description :
Non Conding Region
Location :
Scaffold_1:47992- 48480
Sequence
488 bases(100 bases per row)
TATAGCAACAGGGTAAGGACTATCCTATGGAGACCGAGGACCTGTGGAGAATAGCTAGAACTACGCTTGAGATCCAAACTCTCTATAAGCACAAACCTGT
GATACATAGAAAATAGTGTAGTCTTGGTTACCCTGGTTGGTCTACTGCTTTGCAAGGTGGTGGTCACCCACAGTTTAGCTATAACTTCATAAAATAGGAA
CCGACTCGTGGAATTCAACGCCGTGAGTTTGGCTGATCAGATGATGAGCCGCCTCCCATCCCGTAATTGCATATCTGGCATTCCTGTGTCCTCCAGTGGT
ACGCCCCGTTGATAACATCAAAGCCAACAGCAAACTCGGCGCAATACCGATCGTACACCGCTTCCCACTCGCCGAACGTTACGATTTCGTACTGGCGGGC
AGGAGTCGAGCCAAGGCTGCAACAATTCACCACGAAAAAGCCAAGTTAACTTCATAAGCACTAAACCACATATCCAACAGAGACAAGT