Description :
Non Conding Region
Location :
scaffold_1:47982- 49476
Sequence
1494 bases(100 bases per row)
ACTCCACTGCTGCCTGACCTTACTACGTGAGACCAAGCAAATTGCAAAGTGATGAATGTCTTGTCGTGTTGTACCACCGCCCCACCACCCTCACTGTCTG
ATCCACAACCGTCTATTGATCTGCTTTCCCTAGTTACTATCCTATCTTGGGCCTATAATGCCAGCAGAGCCAATAGGTAAGGCATCACCGATTGATGTAA
GAACTACTTCTAGTCTGGCATCTGCACGTTCTTACAGAACAAGCTCTTGACCACGTTCATAACGCGATCGTGCGCAGCGTGACTTGTGAGTGCTCCGTTC
CTCCCAGATGACTCTTGATCCTTCTGGAGCTGGAACAGGTCGTCCAAGTGCACTCTTCTCCGCACTTAACCACCCTCCCGCCAACACAATTCATCTTGCA
CATGAACAATGTCTAGAAGTTGTAGACGCCATCATTGCCCATTTGTCGAAGAGCGAATCTGCGGTTTCTTCCGCGTCGCGTTTTCCTCGAACGGGCTTTT
GCTCGACTTTGTCTGATGAAGTCGATGGCGGCATCAGAAAGTCATCAACTAACTCGAGTTTGAACCACTCGGTCGGATGAACGAGGATTCTGCCGTCTGC
AGGTGCCTTCTGATGCCTGTTGGGTGGGTCCGTCCTCCGTCGATTTCCACTTAGTGGAAAAAGCGAAATGACAAGCAGGTATAGAGAAGACTTCGTTCCC
AATGGTGTTTTCGGAGCCCTGGATATTTGGTTTGGTGTCCACGGGTTTACCAATGTACGTCGAAGCGGGACCTCGGATGGGTGGGGATTGGACACACGAA
CTATGGTGACAACAGAAGGCAGCGGCTCATCGGTGGCATTCTCCAACGACAATGCAATGACAGTCGCAGCACCAGAAGTCTCGCTTCACGACTTCTGTAG
TCTACGATGAGTGAAGTTGATTTCGGGTAAGCTGCAAATGCGTTCTATGCGGTTTTGTTGTGTGGGAGTATCACGGTGGTACGTCCGTATACCTGTATCC
AGGGCAAGTGCTGCAAACGCCTGCCGATAGCCTCAAAAGCCACATCACGTTTCTTCACTGTGCTAGGAGTTTCTCCATAGGGATGCTACATGAAACCAAT
GGATTTCCATGCATTCATCGAGGACGCGAGATAGAAGCCGATCACAGATCCATCATGGCTTATCCGATAAATTATCGGTGGGGCTGCACAGCCCGACCTT
GGTGCCCAATCTAGTCTGCAGTGGTATTTGCATTATCATAGGTCATGCTTTCAGTAGTAACTAGACGTAGTATCCAATGCATTTTGTCAGTTTTTCATAC
GGTTCCACGACGCCATCTGGGGTCAACTGCTCTGACTTGTTGGCCTGGAACCGTGCAAAAATTTGCTCCCACTGCTTGGCAGTCCCCAGTCTCCCGTGCG
TCGACCAGGTGGGATCTCCGTGCTGGTTCGACCAGTATTCGAGGGTGAAAAGCTTCTGTCGTGCTGATGCCATCTCCACCGCCCGAGGTGACCA