Description :
Non Conding Region
Location :
Scaffold_1:47940- 49383
Sequence
1443 bases(100 bases per row)
TCGCTCTCCGTGGAGACCATCGTGACGCCGACGATGGTTATCGCAGTATGAGCCGTTTCACACCTAGTACATTGCCGTTTCTTGCTTTTTGTCTTGAAGA
AGACAAACGAAGACGGCGACATCAGCTTTATGCAAAACAGGACTTGGCGCCATCGTCCCAGCAATCACGAGCGAGTCGCGGCCTTCTTGGCATACTGGTC
AGCATCTTGAGAGGCGAGGAGATTCAGCGTATTGAATGAAGTCGTGAGGTCACCACTAGGGCTGGCAAAGCCGGCTTTTTCGCATTTCGGGGGTCGTGTT
GGTCTGGACCAGCGTTCCGATTCACTCTTCAAGGCGGAAGGCCAGCGTGAGGCAACTGAAGAGACGGGATCGTCTTTCACCGAGCTGATAGCTACTTGGA
AAACAGCTCTCCAGCGTGGCAGTGATTCCGTGCATCGGTCAACGTAAGCCAAGCACTTCCTCTCTGCGATATCGTACCTGTGTCGATCTGGTGCCCTCGC
TTCTTGACAAGAGGTTCTTGTCGACTCCTCTCAGGCCGACACTCTCGACGCGCTTCTATACAGCGCCGTTCTTGTCGCATTCCTTGCTGATCAGCAACGC
CACGCCTTGTGCGGCGGAGGCGTCACTCGGTCGCTTGGTCGGCGCACACAGCTTTGACAGCCGCGCGTGGACGGCGAACCGATACCCGTGCAGCGCAACG
CTGGAGTCTAGCGGCTGGGCCTCTTCGAGCTGGACGTCGACAGACAGCCCCTCGCACAGCTAGGACTTGGACGGCGAAGATACCTCTGCAGAAGACGGCG
AATTCAAAAGAGGAGCGCTCCCTTGCAAGCCAGCCGAGCTGTAGACTACAGTGTAGTAGCTTGTCAAAAGGAAGCTCATCCCGCCACGTACTTGAAGTTG
GGAGGTTGAAGTAGTCTGGATGATACCGCGATCCAAGCTGCCATATGGACGAGCACAGCTATCCCAGCAGTGCTGGGCCAGCACACGGACCTGGACGTCG
TCTCCAGAAGATCTCGTCGTCGTCACATGGCGAAGGAGGGCCTCAGGTGTAACGTGTGGCTGCAACCTGCGGCTCTGATCCTCAGCGTGGCCTGCACCAC
CACAAAATTGATTTAGAAAATCGCAATCTAGCGTGACAGAATAGCGCCTTACAAAACCTCAGTACAACGTCCTGGACCGCCAGAATTAGAAACAAGTGCG
GTACAAATCGTTCTCGTAATCGCGCCCACCCTTTATATTGTGTCATTATATATACTTATAAGAGACCCAATACATTCGATACAACAAACTACCTTTACGA
ATACATTCCCTCTACTAGACGAGAGCCCTGACGTGTATCTTTACAGTTCTATGCGCCCCTTGGTCTGGTGATGTCCGACCCGAGCAGGTTCGCCATGGTC
GCCAACGACGACCTCCTCCCTCATTTCCAGATCTTCCGCGAAC