Description :
Non Conding Region
Location :
Scaffold_1:47589- 48071
Sequence
482 bases(100 bases per row)
TTGACATCGAGCGTCACAGGAGTAGAAGAGGTCTTTGTGTTTGCTTTTGACTGGTTCTGAGCACTTGGCTGAATGCCCTCACTCTGCTGGATGGTCTTGA
CTTTCGCAAACATCTCGGCCAGGTCGTCCTCATCGTCATCGTCCTCATCGTCATCGTCCTCATTGTCATCGTCATCATTGAGATACGCGTTCGCGTAGCT
GTCGTCTCCCTCATCGCTCTCATCGTCTCCTCCATATTGCTGCTCTCGTTCCGTTTCATCCATTTTTGAAAAAGGTATTTGGAGAATGGCTGCTGAATGG
AAATGGGAAAGATAAGCGAACGAGTGAGTGAGATTGCTTTAAGAATGGGGAGTGGCTGCAGGAAATAAATATACCGGTAACCCACAGACAAAACCTCCTC
AACGGCTTCACAATCAACTTCGATCGAGCCCGCCTGACAGCAGCAGCAGCAGCAGACAAGAGACAGGAAGAGGCTACCAAAA