Description :
Non Conding Region
Location :
scaffold_1:47323- 50772
Sequence
3449 bases(100 bases per row)
TTTGGTTGTCAAGAAATTCTATGGGGGGAAATTTGACTGGTCCATTTTGTTTGTTTTGTTGCCACGTGGTTTTGATAAATTGCAAAGTTTTCGACAATAA
TGTTGTAAAATATTCAATTATATGTCGTGGATTCTGAGAATTTTCTTCAAGATCAATACGGTCAGGAATGTAAAATGTAGTGAAATAAAACACGAAATAA
TCTTCCCGAATATTACTTTCACTTTGAATACTGAGACAAAGAGCAAGGAAATATACGCGATTAACATTCGGTACGAATGATGTCAAATTGCTCATACATA
TAAAATCATAGCTGCGAGATACCCTTTACTCCATACTAGAACAAGCTCAAGCAAATGCAGGTCGTGCTTCCGCGTAAACGTTGTTTCTATATACTCGTTC
AGAGTAAACAACAATCGCACGACACTTACACGACCTGCACTCACTGGAGCTTATTTGCTTATTAACAAAATGAACACGGCGGATATCGTCTCCTCATTTT
CCATATTCATGTGCACAAGAGTTTGACCTCGGCACACGAGTCGATCCTTTCTGGGTTAGCTAGCTGACGCGGGTTCtcgaagtcaaagctttttaaTGCG
CGAGGTGCATGACGATTTCGTAGCATGTCGGATCACAATTGCGAGTTGAGTCTGATGTAGGTTTGAGCGGTGAAGTCCTCGGGTGTATTAGCTCTACAGT
GCGTAAGAACATCCCTTTTGTTCTAATTCACAAGGATTACATCGAGAATTTGATATTACTTACCTGGTATTTAAGTGTGCAACGGAGTTGTTGACAAAAT
TTAAGACTCTGCGTTAATAAACGCACAGTGGGTGCTTTCGTGACAAAGCATCAACTTTCATAATTGTGATGCTAATTGTCAAGCTCGTGACTCTCGTTTG
CGAGCTTCACCTTCTGAGCTAACTCTGATCCGGCAGGGGACTAAGTCACTTCATGTTGCCATAGTAATGACTGCATTACTATGGTGGCAACATGTCGTAT
GTCGAGTTGTCTCCAGAAGATCGTGAAATGTTCCATTAAGGTTATGCCTATGATCCTGAGCTTCAAGACTCATGGACAAAGTCTGATCCAGGCACGTTGT
TCAGAAAACATGAAGAATTGTTAACTTCTAGTAAAGTTGCAAGACGTTGTGTTCCGAACAAGTATCGCTTGCGACTTCAAATTATTTCTCAATATCATGA
CTCTACAATAGCTGATCATCCTGGAAATCGAAGAACTTGTTTTACGAGTTGCGCAATGGCTTAATTAAAAGACAATGTAAAATAATATCAAGGAATACGT
CAGGGTGAACCTTGTACACGCTGGAAGTATGATAATCAACGCAAAAATAATTTGCTAATGCCCATTCCAATCCCAGAGCAATGCTGGTATGTTGTGTCCA
TGGATCTTATAACAGGACTTCCTGTTCCAAATGATTAAGATGTAATTCCAACTGTTGTCGACAAATTGTCGAAACGTACCAAATACACTGCAGTGCATGC
GAATGATGACGCACCTGCAACAGCAAAGGATTCGTTGAAGCTGTACTTCGACACCGTGGCTTACCTTAGGTGATCATCATTGACAGAGATAGCAGGTTTA
CTTTAAGATTCTGTAAACCTCTGATGACAATCATGGGTGTTCGACTTAGTATGACAACAGCACATCGAGCTCAAGTTGATGGACAAGCTGAAGGACAAAA
ATTAGACgttgaagatgcacttagaTGAATGGTGTCTTTCCATGGTACAGATTGGACAGATTACTTAGGCACCATAGAATATGCTCATTCGACACTTGTC
AGCGCATCCACGGAATCTTCTCCCTTTTAGATTGATACACAGAAAAAAGAATGCCGTTAATGGCAAAAGGATTAAGCTCAAAGTGAAAATTTATGTACAG
ACTAAAGAATTTGTGAAAAAGAACATAAAATAATTGAGCAAGCACGAAAAAATCTACTTAAGGCACAAGCCACtaaaaagcaaaattatgatcagaagag
aAGAGTTAACAAATTGACTATAAAGCTGGAGCTAGTTATGCTAGATACGAAAAATTCCGCTCAGGCATGCTACCAAAGATATGGGAAGCAAAGAGCAAAG
TATGCAGCAAGAAAAGTTGGGCCTTTAGAGATCATCAAGATGATATATCCCAACGTGGCAAAACTCAAGATGTCACTAAGCATGAACGAAATTAATATAG
CCTTCAATGTTGATATGctacaaaaataaaaatcaaatcCAGATAAATTCCTTCGTCGTCCTATCCCCAAAGCGTCCAAGTTTGTGAATAATGACTTAGT
GGATCAGCTTCAGTTCATTCAGCATCTTCTAAAGATTATACAGTTTAATTGCCAACCAGAATGGCTGGTCCAGTAGCATGAAAAACAGAAGAATTAGCTA
GCTAGAAAAAGAGAAATATATTCGGCACCTAGCTCATTGGAATGATCTCGTCGTCGACTTTAAACAGCGCCAACGAGAAATCAAATTGGGGAGAATGTAA
GGAACCATACTCACATGTTCCACGATTCTAAAATACGTTCTAAAATGTTAGTGAGTGTAGGTCTCATGTTGACGTATACAAAATATACCCACGTTCAAGT
AGAGATGATACATATATTCATAGTAGTAAAATGAAAGGCGACATTATAGGAGGAACGATATGCAATTAAAAATCAGTGGGAAGAAATAGGATAGGTTACA
TATATCGTAGAAATCAATCCAACAAATAATCTTAATTCTTGATTCGCTAACTAACGTCCAACACCTCATAAGTGCAAACGATCCTTACAATTGGTGGCAC
TTGTTGGTCCTACAAGTCCTACCGATGCCCCTCACACCATCCTCCGCCATGACATGAGTCACACACAATCTGATATATATTGTCTTTGTTTAGTGACTGA
TCCACGAGCAACCACTTCGCCTGAAATGTGCACTTGACCGTGCGTGCTTCCACAAAGGCCTCCTCCTGTACATCATATTAGCTGGCTTAACGAGCTCTCA
GCAACATCATAAGCCCATTTAAAGATGCGCTAGAAACGACATGATGAACATGCTGAGGATTTCCGTACCAGTTACTCCCCAAGTCGCAACCAAACACCTC
TGCCTTCAGATGCCGAGTTTTTTTATGAGGGAGGTACAGTGACTCCCCAAGTCGCAACCAAACACCTCCAACTTCATCGGGCGATATACGACTGAAGGAG
GTGCTAACAGTTGTTAGCCTTTATGCTGCACGAATCTCGAATTTCGTGACTTTTCATCGGCGGATGGTAATACGACACCCCGCCCTGAAACCCTCGACGA
TAAGTTCAGCTATTGAACAGAACCTTGCTCAAGGTACTTAGTTTGCTTTACCACAAGTGCAAAAGTCACGCAAATGTTGCTCAAGTCACGTCGTGATTGT
TGATACTTTCATCGCCTTTTTTGGTATTGATAGTGCAGGATTAGCATTA