Description :
Non Conding Region
Location :
scaffold_1:47080- 47325
Sequence
245 bases(100 bases per row)
GCAACGACAGGTTGATAGGCTTCTGAAGTCGGAGTACCGGTAATATCGATATTTCACTAGTCGTTTTAGGAAGAGATGGCTGCATTAAACATGGTTACAC
ATTGCTGAAGTAACGATGCGGATGCAACTCTTATTCCTGCTAATAAATTAATGCTGTTTAGGCTAGACCCCGCAATAACTACTTCCAAAATCATGGCTAC
AACGCGCTGGGCGGCCTGACTAGCCATTGTTCATTGTGCTTGTGT