Description :
Non Conding Region
Location :
Scaffold_1:46943- 47001
Sequence
58 bases(100 bases per row)
TCGCTTTAGCAAAACCTCAAATGATCTCTTGAGAGCTCCAGCTTTTGATACCATGATC