Description :
Non Conding Region
Location :
scaffold_1:46744- 47293
Sequence
549 bases(100 bases per row)
CTGTGCACACGACCCCCGACATTCACTCCGCGAAGAAACGCCACGATCTTCCTGCAGCCCGCCGAAGATCCTGCTTCGGACTCGCCTGATGCTGCAGCAG
AGCTCTTCGCGCTAGAGCGGGCAGTCCTCTTGGCTCTGGGAGGGCTGTTCGACGTTGCATCAGCTTTCCTTTTTCCCTTCGCCACCATCAGAGCAGAAGC
TTTTCGGAGATGGGAATGGCTACCTGAAGCCATAACTCCTCTGCCGAGACGTCATGCAACGAAAGCGCTCTTGTGCATTCGTCTACATTTGTTTATCTAG
TAGTACCTGTGATAAATTATATGAGACCTCATATTCATTACCACTACTGTTTAATGTGTTTGTAAGATGGCACATATCACTCTCTCTGTTGCCGCCTCGT
TTAAGACCATCCCGTCGCAATAAGGCTTTGTTCCGCCCTACTGTATCGAGTCATAACCGACTCTCCTCTCTTCTCTTCAAGCGGCTCTGTCTCGAGGCGT
CGCTGTGGAGCGCCTGCCACTTCCGATCTTCGCTTCTCCCTCGCCAACA