Description :
Non Conding Region
Location :
Scaffold_1:46555- 47137
Sequence
582 bases(100 bases per row)
TGGCACAATGACTTCGCCGGCAGAGAGCATCCGGACAGGCCTCGTATCCGGACGGGAGAGTGACACGCGATCTACACAGCTTTTAGTCGATCACGGTAGT
CGATGATGTAGTACAAAGCGCCACCGAGTTTCGTCGTCGCCTACCACACAAGTTGACGCGCATGGCTACGATGACGCGCATGGACGATGACGCGCATGGA
CGATGACGCGCATGGACGATGACGCGTCGCTGGTGGCGGTGTCCACAATGTATCTTGCGATCTGTCGCGGGGTTGAGAGCTTGGTCTCTAGACTGCAACG
TCAAGTCATTAATCTATGTATGTAAAACGAACTACTGTAGCAAGGTTGTAGATATCCCTCGTACTGCGCCAATGCACTTTCGACTCGGTGGTACTAGAAT
CGCAGCAGTCGCACGCGCCGATCACCTCGTCGCGTCACGCGACATAGCACTTATGTGAAGCCAGGACCAAGGGTATATAATAATTTATTATATACCCTTG
CCAGGACATACAGTATGACAAATTTCCCGCGCACGCAGCTGTTGAGCAACGCGTCGTCGCCAGCACCGCAGAAATCAATTAG