Description :
Non Conding Region
Location :
Scaffold_1:4642- 4794
Sequence
152 bases(100 bases per row)
CTCGTTGTGCGTGCGACCTTTCGATCAGCGCATCCGTGTCCCTCTTGAACTGACTGTTGTATGCACTGTGATATTTGGATACGTCATTTCAAGTGGGACA
CTCACCACCATGATGTGATTTTTGCTAATCTCAAAATCAGTGAAGAGAAAGA