Description :
Non Conding Region
Location :
scaffold_1:4633- 27238
Sequence
22605 bases(100 bases per row)
ACACCTTGCTTGCGAATAGCTAGTAGGGAACAATTTGCCGTGTGATAGACACGTCTTTGGTGGCTATAATAGCTGTCAGTAACGGAAAAGCTGGTTACAC
GCTCTCCTGCGATGAGGTAGCGTAACCTTGGGCCTTAGTCTCCCCGCGTAGATGTCGTACACGCCCCTGTAACCACAACCGTGAGTGGATCTAttgatca
aatgaagactgaatatattgaaGGTGGTTTTATCCTAATCTCTACCGAAAACACGAAAAAACGTACCTGTTTGTAAACAACTGTTaattaacggattttt
acgaatagtgatcggtcttttatttattagtagcctcaagaaaNNNNNNNNNNCGGCTCTAGGGAGCGAGGAGTTTGGaatctcggacaagaaattgtca
tcaagattgcgtgcacaattgcaacgatattcgttgaataatgggttgctatattatagcaccaattcaacggatacaccacgaattgtggttcctcatg
tcGAGGATTTTAAatatatcgcatcctctatgaggctcacgatacaCCACccaatggtcatctcggtcgtacaactctgtgagtcaccactattgggtgg
cccaagttgtacaaactgatgagcacctatgtgcgcacgtgtgagaNNNNNNNNNNaccgagttggtagacaccaacggtgtatcggacaggagtcccga
gcgtggcaagcgggctgatcgtggagtggcacgtaaaccactaagcactgctcatgttgtgaagcagttgctgcatgccattgatggcgtggttggaCAT
CTGGGCCGcgacccttcagatgcgcgtagagtggcacattatccactggacgaatactgcggggttagcagctctttgtcggacgTTGTATaaaacatcg
gagctccaaaggagcggacagtgagggtgataccggacgacgcgaaatgcgtgttcaccctggtctcaccgagacatagaacctctgtacagaggcgaag
gcgacgccgtatgctggctgcgagacgccgggcgtcaaccctgatccaggatgTGCCTACCGTTGATGACGGTGCACAATTattcaccctcgtcaacggt
atgacagggGAGGACGATGGCGACCTCCGCcttgaggctatgcctgcagtagatgctcttcttgagctggacgagatgtcccttctagagttcggcagtg
ccttgaaggcaggcaattttgccaaagtggtcattgtgtACGACCGGATGAGGAGGTAAACCCGTCATCGCTTTTGGattaagctgtcttggaggacacc
aagagagtgctgaacgcacgaagtggatcgtcgatcctacagaATCCCTTCGATCCATACCaatctttggtaaaggaagttcaagacgtcgtctccaaag
acccgcctccGGTCCTATCTTCGGACAGAGGTGTGCTTcctgagatcgacctggtttcggaaatcaaatactgcgtaacacgccaatcgCCTCTGCCCaa
tgagcagtgcgacgtcattgacgcctttttccgtgcgaagcatgaAGCAGGggtggtacgtgagagcaagtctccccattcgacacccacgttttgtgtt
cggaagccgtacGGCaggtggcgtatcgttcatgcttacaataagctcaacgctgccattattccggcacagacgccgattcctagataGGAGTTTCTTc
cgaacaacatggtgggatgtaggaagtacagcgcactcgacttggtcgatgaatatttccaattgctcatgagagcgagtgatattccgctaacagcggt
gagcacttcgagcggcatgctctgggagtggctggtgatgcctcaagggctgttaaatgcaccagaaacatttgatcgtcttgtgacgcagttgttcagg
ccccacagggcgtatgcacagacatactttgaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGCAAAGAAGCGAATCGATACATTAGTGGGGCTCTATATGCGATTTTAGAAGCtgaagccaaagcattcaagGAAGCAGAT
CAAGAGAGATCTGTCACTATTTCCACCGACAATGGATGCAGTCTAAACGGTGTATCCGAAGAATTGGTGAAGAAACTTAACCTTGAAATCGCTGAAGGTA
AGATGATGCGAGTCGACCTTGGTTATAGCCAGTTCGTACTTCGTCCACGCCGAACCGTAGAGATGAAGCTACAAGTACCAGGTTTCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtgatcgcgtttccttgccgcccgactgggcaacaaggaattggtggactttttcgaagagatgc
gaactctcattgccgggacggcagcagatccccccCCGGAGGCAGTCACAGCGACCGtgttatggagggcctccgcactggcgtggtcagaatggaagtc
ttccgtgtgcatccgtcttcatttgaagaagcggtgaatttggcattgaatgtcgaATTCAATCTTAAATCGGCACGACTTCGTTTAcatgcacactcca
atagctcgtcgagcgggcctgcgCCCATGGACCTCAGATATGCTGCCATCGAGGgaacagagctccgagctgccgagcagcacacacatatacgacggtg
ttttgtctgtggagacaccctcctgcgcaaggcgcgtatgGTTCATCAAATCATCGCCCCAATACCTAGCAGTCGGTTTCGCcgtggggaaacgacacca
cccagtaggcgcggagcgTCTTNNNNNNNNNNAACGAATTTGATccacaccgcgtatgcgggtgatgggaggtgtgtagcgctgctacgggctatcgaaa
gcaaggagtttggaaactcggacaagaaaataATATCAAGATttcgtgcacgattgcaccgatattcgttagaTAACGGCTTGCTCTATTACAGCCCGGA
TTCAACGGacacgccacgaattgtggttcttcatgatgaggatttgaaatatcgcatcttctatgaggcttACGACACGCcattcagtggtcatctcggt
cgtgagaaaacgtacaacattgtcagtcaccactattggtggcccaacctgtacaaatggacgagcacctatgtgcgcacgtgtgagacgtgtcaacaag
taaaaccctctccaaatgcggctgcgccgctggtcaaCTTACCAAtaccactgggtgctgaaagtccatgagtttggactttggttttgcctgccgaaag
attcggcgggcaacatgggtgtcgtggtattcgtcgaccggttgagNNNNNNNNNNccggaggcggtcacagtgaccgtctttatggtaggcctccgcac
tggcgtggccagaatggaagtctttcgtgtgcatccgtttccGTTTGacgaggcggtgaatgtggcattgaatgccgttttcaattttaagtcggcacga
cttggttggaatgcacactccaacagctcgtcgagcgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNattcaacacggac
tcccagagtcgattgtctctgataaagacccccgtttcacaggaaaattttggtcgactatcttcaaggtactcggcaagttggatatgtcgacagcgga
tcatccgcagaccgattttcagaccgaaagggtgaatcgcatcattgaagacgttcgtCGCAGCATCTGCACTGAGACaagaggcgctggagcgccatgt
tgccactcgtagattttgcactgaacaatgcagtgcattcgtctaccggctacacgccgttctacgtgaacgggctgattccgCCACGCGTTTCGCTGAC
GCCGCAatctcatggctcagggcgtGTGGGGGAGGaacagccgaacggctagctgatgtcaccCTCCTCACCActtgcaaagaagtcgatgactttttgt
ctaccagactgagtgtccaacgacacgttcgcaatgcgatgactgaaagccaagacctgcgaaaagaatatgcagataaaaatgaagaggcaaagtggaa
agattTAAGAtcgggacctggttttattcagTTATAAAActctgcctacacatgcagcctctgctatcttccggacgaagcttcgtccagggTTTATTGg
cccgtttaaggttgtggccaagcggggcctagcgtatacgctaaatctcccaaaacggatgcgcacccaccccgtgttttacgtggggttgctcaagccg
taccgggatccggcgcaagtgaacgcggaagcgttggcgtcaGAGCaaatcccacgggccctcggccacccagaagctgaaccagcaactggttctgagc
atggaGNNNNNNNNNNTatcttcatcgattccggaccgttgggcaattatgcttgtcGCTttacgatggaaggaagtcgtctgtatgctgaggcgctgaa
agcgcgattgggtgacatcgtcactgtttgcataGCGCAGGGACAcctgtcacggtcccgaaggaccctgtggacctcggagtcaactTCCTTGActctg
atagcgtggaacgctgtttaGTTTTAGACTCGGAGGTATgacctagaaaggatgttcttcagtacaacatggtgggatgtacgaagtacattgcactcga
cttggtcgatgggtattactaaTTGCTCATGGGAGCGAGCGATTTTTCGCTAACAACGGTGAGCAATCCGCGTAGCattctctgggagtggctggtgatg
ccccaagggctgtcgaatgcaccagcaagattttatcgtcttgtgacgcagttgttcaggtcccacaGGGCGCATGCACAGTCATACGGTgaagacattt
tcgttcatagtcctCCGGAGcgcgggaggacagatgaggagaatcacattgttcatttaagagcggtgcttgagtgcatgcgcacgaacaaactgttcgc
caatgcagacaagtgcatctttggcgcaaaaaagattcccttttagggtgcttcattgggaagcgtggccttcgagcggatcccgctaagNNNNNNNNNN
TGACGGCGATCGTCCCGGTCGTCAACGCCCGCCGCTGActcatctcgatgagaacggtgacgtccactatcacgtgggacGTCTAGCGagatgacgtcgt
cgccagggtcaaacccaatatctggtgaagtgatgGGGATatccgactccgaaaacacATGgtagtttgaggcgccacttcggaaGATTGCCctgtcgcc
gtggacgcttttgatcagaaagatcaggacaccccacgtcatcagacgccccgcgctttccgGCAATATCCAGGGGAGTAGGAGGGCCACgagttgagct
caagcagtggtcctgagctcttgcggtcgcagacacagagcgaGCGGAGCATTAAGGGCTAGCTCATacatcgcagggcgacaatccgaaggaagtcgac
ggcgtaccGTGCGTTTGGCAAAtccaaatcggaggtgtcgctccacacgcacgtccacctccttgtggctcgactgtaggttatacagtgaggaaaattT
CCGGtaccgttgcacccatcgctcaaagagcacttcgtcatctgtagcgcttttttcaggggcgagcacgacaggtattgtccgcattgcgggtacacga
cagccacctcgttgagcactcggACGAGTGCGAAAGGCTACCAACGAAAATTCttttgggaccaagaaacgagctcgaagagcttttcgtttggccagtt
catcttccgttctggttgtggacccgatgatgtggactcGTAacaatcgagttaccgcgtcctttgcttccacagcgggatctgctgggcggaagccata
ttccacaagaGGGTCAAttaccggccgtggatgggcgcgcttcagagccgccttatgggcagattccagctgccgcctcacTGTtctgtcgaggtcattg
ctgattacaccacgtccctcggtTGATGAGAAGTCAGAGAGcgaacatggggtccgcaaggcgcgagcagggcttgtaacacgccgctggcgcagctcgc
ttTTCTCGTCATctcatgcgggaaaaggagtgtcagactcgtagtcgaccacctccacatcctcaacgaggtcacttgtcattgatagcgtgagcAAAGC
GCGCcgatcgtgctcatcgagcctaggatgtatatcccccggtgccgcggacgcactgtccgacattgcaccccgtgcgggagacgaagttgggctctgc
tcgtgttcgctgtcagaaccagtgaGACTTTGTGACCatagtgtcgttgacaaagGGTTAATTGAGCCTGGAATTCGTTTTATTTCAACAAATTAGGTTG
CAGTGtttagcggacacgcgagcctcgttgaggcaataatcgattggaactgtaaacgcTCTCcatcttgatgggggagagtgtaacggggttacatgta
tcctagtaacaggtgtgtgtgtcacacgagatgggcatggtgtgactgcacccacacaagaatacggtaggTGGCTAggaagccagtagttatgcatgta
tttagattttactatatatattcaggAGAAttcaaaaatttaaaattcggcggctttgccacatATATAAattagttttggattttaaacggaagattaa
ttagccttggattaaggcagtaattactcttggagtaagcggattgcgatctgctaactcgtacttgttctaatgtagaacgaaaggtcagtgacctaag
ttacacttcctctaagcgtaacgctgcggcagccccactgcagtAACAAAGCCGAGGTGATATACAATGATAATGGTCACAGTGACTCGTCGAGTGCCGA
CCCAACACCCCCAGAAAAATTTAGAGAAATACGTTCGAGAATTAGCACGGAGATAGGTACTATTGCGCTTCGCGTTTCGTTCGCGCAGCTTACGAGCTCC
GTATTCTTTTTAATGTTGTTCCACCTAACACTACGATGAGCTGTACCTAGTACAGCTAGCTTgtctgcaagcgcaagagtcaAGTTGACTGTTGCTACAA
TTATGACATCGTTGCTATGGGTTCAAACAACCAGAAGTTGCTTGATGCACCAGGTCAATGCCTTATACGCTTGCGAGCGCGGGACTTCAACTCACACCGA
GAGCAGAGATAGCTAtagaaaatttctttttcgaAAACTTCCTCCTCTCACGGGTCATAATATGTACCTCCTGGTCTTAGAACGGCAACGAGACGGTACT
ATAGTTTCTCGAACTCAAATTCGTGCATCTCGTACAGGTTTGCCGACTAGACTCGTGAAGCGGACCTCCAATGCGAGCAAAAATTAGTACTCGGGTCAGC
AAAGAAAGGAAGCACGAAGGAGACGTCAAGGTGAGTCTCATCAACTACTTGTTCTTATAACTAACTCAACTTGCCTTCATGATACAGCTGCCACAGCCAC
CAgacaaatgaaaaaaaacacAAAGATCTGTTGCCACGCGCtattggaaagcgtgttgGGAGTAACAACCCTGCCTTATCTCAACATTACAAAGGGTGCA
CCCAAGTCGTAAGCGGCAAGGGCGCcataaaattttgaaaaagtggAGGCTAACACTCCTACGCGCTCTCACTGcgcgaaaaaaaatcttcttcaCTAAA
TCCTGCTACCAAACGTTCCTGATATACCCGCTCTGTCGCCGGACATTCCGCTTGAAATTGCGTCCCTTATTATTTGCGTGTGTCCTGGTCCCTCTTGTAG
CATGCTCCCGCGCGCTTGATTGATTGTTGTTTGCGGTGACTCACTAACTTTATCGGAGTACATCCGCGTGTGTCTGGGTTATTTTGCAGATCACATTTCA
AATGCGCTCTTTAAGGTTAGTTTTCAAGGGATTGTAGTGACGCTGCTCCGTCAACTACATAGTGTTTTTCGCCACGACTGACACGTTAAAGTGGGGACGC
GATATAgatcagcaagcccacgtatgACACATAATTTTGCAATTTCGTTGGTATGCCACGAGTATGCCTCAACCCGGTTTTGCTACCACCGTATAAGGTC
ATATGTAGCGTGGTCGAATTTTGTCCTATAGGCTGCAGTCACTTCAACAGTAGATAGGTTACCACTACAATTTAAGGCTTTTTCCTCTCTGCAAATTCAT
ATGTGTTTTTGTCTGCCTAGCCGCTGGTACAACATGagttgctgatatcagcccgactgatttttgtttttatcaaatcaaatttcaTCTCATTGAGATT
GTACGGCATGCGCCAAGTGCGCGACGCAATGGCTGCAATAGCTGATGATCAGAtttttcaaagtcaaaaCGCTACCGGAGTCACAATGTGGCCGTGTTGA
TATAGCCCAGCGGGACCGAACTATTCATAGCATTGGCATAGTAAGTAGATGCATCCACTGTGTCTGTAAAAATGACAGGGATCAGCTAGCCCTAGCACTG
CAAACTATTCGGCCAGGTACTTACGAGAATGTCCTTCAGCACGCGACCAATGGGTTTCGTCTGACCATGTCGTCCGTGgatggccgaccatgccatgtTC
AATCTGGCACCTAACCTCTAAATTTGGGCTcgccaaaattttgctgtaagCCATAGATCCCTTACTGACACAATGGCTACTGGCTGGCCACGTTTTTGAT
AAACAGAACGCAGATCCGGCATGACGTcgtttgctgttgctgtattTTATGAGTGTATGTTATGGTTCATACATGGAATAGTACATAAGTAACGAGACCA
GCGAACTAACTCATTTTCTTCTAAGGGAAGCCAAGTTTGGCCACATTTAATGGAGGATTCAAGGGGCATATGGCCATGGCTGAGGCGTCCTTTAACGATT
AACTTTGTAAATTTTAAAGCACGGCACGGACATCGAGTTTGTTACTCATTCCTCAAATTTCTAAGTGATGACAGTATCGCTTATCTTCACAAGACAGCTA
TCATGCTTTTGAGCTTACAGCAAGGTCAATCTTCACTCGCTACCTTAAAGCTCTCGGCGTCGCGTGACCCCTGCGTATTCTCTAGAGAATGAAAGCCGAG
GGTGGATCAGCTGATAAGCGGCCATCAGGCCATGAAAATCTTGCAAAAGCAGGACCTTAGACTTACATGACTTTTAGATGGTGCTCCTTCTACTTCACTG
AATATTGGTAAAGGTAATGGTGTACACGCAACTACTAACCGTTCCAGGACACACTCGTTGCTCATTGAGCTGTGCTAGCAACAGACGATTCTTCTTTGGC
TAGCACCTGTGTGCTCTCTCAATTGTGCTGATCGAAAGTGATACTGGCCGATCTTGAATGCGATATCTTCTCTCCAATATCGCACTGCAATATTTGAGGC
ATGACCGGCGGTTCAGAATCGCATTGCTGTTCTAGATTTAAGGATATAGGAATTTGTCAATACACATTTCTATCTAGGTTAGAGTGCCTTACACTCTCAA
TTCCTCTTATGAGCAGGGTCGTATTTGCGATTTGCTTCAGGTTACGTGGCTTTCCGTCAATGCATCGCACACAAGCCGTGTATTCTTGTTGACATGATCT
CCTAGATTGGCTGCGAATCGAAGTCGGAATGATGTAAGCGGCTCAAACCGTATCAACATTCCCTCAACACCATAACCTGAGCAATTTTGGGGTAGTGTAA
TAAATACTCGGGGACAGACGTAACTTTTATAGCAACAGagaaacgccttgtgggacGTGTACTAAAAATGTTTTGAGAGGACTTTTTGGCTCGAGTTCTG
CACACCTTCcgcgcaagtgcttcaaAGGATACTTTCTACCACGTGATAGACGCGGCCCATATGACAACCTCgtatgcggatggtgagcAATTGACATACA
AACATTCAGTCGAGTaccgagcaccttaaaaagTATATTTGGCAGATCTTCACCGAGGAACGTAGATCTTAGAATGATGCAATGTGTACCGGCGAGCCAT
GACGGCAAAATGCTTTAACGAGAAACGGCTTGGGAGTATCTTCACCGAAATGCTGTCACCAACAGCAGCAAGTTGATTTATCTTGCCTAGACGGTCTACA
GAAGCCATAATACCGGTATTGCTGAGTGGTTATGTCATTGAAAAGAGCGGAATAAATATCGAATTGATGAACCGCCAGCAATCTACCTAAATGTGCATTG
TAGTAAAAGACATCAGCACGTGTGGCGAGGGTAAAGCCCAGTGACACGTTACACGCatgtgcacatatgtgccTTCCCGCTTTCAATGTTACCCTACTAA
TATGTAGTGCTCGAACAGTGTGTATTGTATCCCCGAGTGGCCATGACATGTGTTTCGTAAAATTCTGTACATAAGATCCTCTTCGAGAGGCACAGGTTCA
CGCTGAGTATCGCTTGGTTCAGTGAATAAATGAAAACTAGCCTAAGGCATAACGGTGCAGCTGTAATAGCGCGCACTTCGATGAAGAAATATATAGGCTT
TCAAACTCCGTGCCTTCGCGGACACTACAACGGAACAATTGCTGCGTATGGTACGTAGGTTGTACGTGTCAACCCATCAATTGGCAACGTCACTATCGTC
ACAATCGACAGATCATAGTCGGGGCGTCGCAAAAGTGGTTCCACCACCATATTAAGCCAGTTCAGCTTCTACCTTGCCTCTAatttatattttgcaaaga
ggAATGACCATCTTACCATTCCTTAAAGTAGATGTGGTATGACGttgctgtgcgcaacgacaCATTGAATATATAGATCGCAAACTGCATGGCGATAAGT
TGGTACATCATAATTCGACCGAAACATATTTCGAGGAGATCCTTGTTAGTAACATTGAAGTTATCCTCGTTCGCCTTCAGCAATCGAGGCTCAAACACAA
CTGCGTGTTCATCCCCATTGGTATTTACTTGACGTTAAGTATAACTTATGGCATAGCCGGCGTCAGAGGCAAGTGAAGTAGCCAATCGTAGATAGAGCCA
AAATTGGGGCACCGTGAGATGCTTGCTCACAACCTCGAAGGCTTTCTCTTAAGCCACGCCTTACAATCATACAACACTCCTTCTCTAAGGCAAGCGGGGA
GGCGCCATGCCATATTAACATAATTTGAACTGCTCTTGTACAGCCAATTTAGAGGTCGAGCCTTATACATAATTCCGGAAGGGGTATAGACATAAGATGG
CCTTGATCGTTGAATTTCTGCGTGTATGTCATGCTTTATATAGTTTTATCTCAGCAAAGAAATTTCACCAGCGCCAAAGGCATACTTGACTCTAGTGGCT
AATGACTGGTTGAGCGTATGAACTTAAGCAATGCTTTTAATAGTTTCATTCAGCTCTCCACATCCGACGCCCTGAACATGAGCAAACGATACCGCgaaat
tgtttttttgcaTAGCTttaacaactgcgtcactagAGATTTGAGCATACCGGAGCATTAGACAGCCTCTGCAGCATAACATGACGGTCTCAGGGCATCT
TGCTCATAGGGTACAGCGTAGTCAAAGGAAATCGCTGTCCCGTTTGATGAGCACCATTAACCAAGTCGAGGGCACAAAGCAAAGTGCAGCCAACCATGCT
TCAAAGCAGTACTTTACGTCAAAAACTTGGTGTTCGTACTGGATAAGAGGGTTTAGCAAGCATATTACAAGCATGGAGTCGCTTGCTGCTGTCGTTTGTG
AGAAAGTCCGCGCAGAGTGTGGGGGATATGCGCGCTAAACAAATCCGCTTTGAGCTTCGCGCAGAGGGACGCGTCTACTACGTTACCATATTTTCTTGGT
TAAAGATCTTGTAGTCTATTAATGTATCTTCGGTTAAGATCTATGCAAGTTTCCGTGTCGCATTGAACGTCGGACTTCTCGCGGGATAAGTCGAGGCCAA
CAGGATCCCGTCATGTCTATGAGAGGTGAGACTTTACAGCTGACGGTTGTTGATTATGAATTTGAACGTCTCGAGATCGGTGAGGCCTCGCACAAATCTG
ATACATCGTGCAACGGGGTACGACGCGAGCCTTGAGAAAATAGTAGGCATTTTGCGGAGGCATTGAAGCTACCAAATTCTCCGGCGTCATGCGACAAGAA
AACAAGATGGTTTGTAAATAGATTATGGAACCACTAACCACTAAGTGGATTTGAGAATCTTGACAGCGCGGGACGTCGTCTCGTTCTGGACCGACAATAA
AAAAAAGAACTGATCCTTGGCATAGCTTGGCTGAAACGCCAGGAATTATGGATAAATCAAAACTCGACATTGCTGTTACTACGCACTTCTCCCTCGGTGG
AGTTTTTTGGAGTTATAAGCCCTCCTCATCAATGGCAAGAAGTTGTTTGGGCATACACGACACCAAAATAAATGTGGCGCCAAACCAAGACCTGTTAAAA
TGATCAAGCAAATATATTGCTTTTTTGTCTGAGCAGAACACGGAAGGCAGAAGCGGTAGTAAGCCGCAATGTTAGGATGACACTGAAAAAATGCTCGTAT
TTGTGGTATTCACAGCAAATCATTTTTAATACGGAGAGAATGTTTTGCCGTGGAATCTTGGGAACATATCCGGTAGGACGGTATATTACAGACATAATTT
GGTATCTTCTGGACCAGACCTGGTGGGGTTATAGAGCCTCTTTCTGTCGCGGTTACCTGCGCAGACGGGTGACACTAAGTCGGGTATCGAAGGACTAGCT
GTTGAAGAACTAAACGTGGTTAGTCTATAACACAAAATAACGGTGCTGCTGAGTCCGCACTATCAATGTACGCGCCCACTTTACCGATCAGTAGATATGC
TTGTGTTCGTGGCGAGAAAGATCTCTCACTTCTAAACGAGGTCTTTCGCTTAGTTGTAGGAGTTGTAGCTTATCCCTTATTGTGCTTATTATTCGCGAGA
TTTTTACTCAAGGGGTATTTGCATGAAATCAAGACAGTGATATCACTATTAGATTCCCGATGGTACCGGATGGGGAGCTTAGTTTAGTCTTCTTCGTGGT
TAGACCTTCACCGAGAGCATTTCCAAAAGCAGATAATATGAGCTGGGTATCAATTTATGAAGAACCTACGAATTAACGTCATCCCTTTTGAATCGGTTTC
TCGACGTGGCGACGAGAGGCACATTACATCTAATCGCCAGTACACCAAAAAACAGATCAGATTCCTGATTTAAAACGCGACGTCAGATGACACAGTATCT
GATGCGCACTGGGCGTAGGTATTTAGGGCTCTCTCGGAAAAAAATCGGTGCGTACCGCGAAGCTGCTTCGTCATAAAAAATGGTATCTTTCTTCTCAGCG
TGGGTGGGGTCCGTTGCCGCTGGTGTGCTCAATAGTTATCCAAATGCGATACCCCATCATCCAGTCCTTGCGACACGAAAATTTGCATCCGCATTCAATG
CAAAATTGACCGCTTCTTTGAAAGAGTTACAGAGGACGCGGATCGTCTCGGCTTGCGACTAACCTGTTTGGATGTCAATTGTCATCGTGTTCAGGAAAGG
ATCTGACGCTGTTGCGACGAAATAAGCTTTTAAATCCAGAACATAGCACCAGCTTTTGCCTTCCTCGGCGGGTAGAAGAGACTTTAAAATGTCATTTTAC
CCCTTGTCAGGCGGGGTGAAAATCTGTGGAACACGTCGCTTCAAATATTGCCATGTTTGGAGCACCTCTTTCACAAAGGTACTGCACATAAGTCCCTTTC
TGGTGAATGGCCTCGTAACTTAGAGACGACAAGCGTGATGCATTGTTGCATTGTCGCATTGTCGGACCGTTTGATGCATGTAGAAATCACATTTATCTAG
ACTTGCCACGTTTATCTTATTCGTCCCAGCCCTCAAAAGGCTGACTATTCAACATGGGCGTGCTTACGGTGTGAGCTGGTCTAGCTTCCTTCCAACGCTA
AGTTCAGCTCTTTCTGGAGGTATCCCGCCAGAGCGCATTTTTACGACTGGTGAGCGCGTCCAGGCGTTCTATCGATATCAGACGTGCCGCCCGTCGGCGG
CCAACTATATACATTAGCTTAACAAGCCTGGTTATATGTCCCGAGAGTAGGTTATCAAGCAGCCCGTGTTTCaacctcacagaggatacagTTTTGGTCA
TCAGATTGATTCCCgcgaagtgcaacggggttgccaaGCACTTTGCAAGGATGAAAATCTGATTTAGCGGACTTGCGCATTCAACGCGCAAAGGTCGAGC
TTAAATTTAGTGGCGGACTGGGAGTCTCAACGGTAATTAATTATTTGTATATCCATATCAAAATTAATTCCTTAGACTCATCCGCATTGCTTGGCGTGAC
GTCACTGACCAAACACCTCTTTTTTACGAAGTCCTAATGTCTTCGTAAGTACCATTGTACTCAGCTCGAAAATTGTTCACTTACACCAAACCGTAATGTG
AAACTCGTCTAACTGTAAGAAATTTTGACTTGCTCCAGATATACTCGTGCCTTTGAGAATCACTTCAAGTCCGAAAGATTGTTAGATCGCCAAAAAAACC
TACGGGCCTCGCTACAAAATCGTTGTTCGTGTGTTCGTGCGCATCGTTGTTTAACATTCTGAGGAATAAGCCACTCCGcgaatccttctgatcatcagCT
TGAGCACCATTGTTGACGACAAAGAAGGCAAAGACAGCGCATTTCTTCAAATTCACATACATTCTTTTAATGCACAGAATTTGGACGACTTTCCAAATAT
GTTTAAGGTGATCACTAACAAATAAAACATTACTTTGAGTGAATTTGGCTCAATGCAAACACTCTCAATGAGTTCCTCATTTTCAGACCCGATGACGCCA
CTGTACATTCCCATGCCGTTTCACCGGGGGGGCTTATTCCAGTGAAAGACATGTTGCTCTCATGTTTATGGATCTGATCAACCCTTCCTTCCAATCGACA
GCGCAAAAGACGGTACCACTTACTTATAATCCAGCAGCTGTCTGAGCGAGTATCATCGCATCATTTCATTGATTGAAGCACCTACGATGCACGGTCAATT
TATTCACACAAATGTGAAGTTGCGACGCGGCGACCTGCCTTCACACATACGACTAGCATTTTTGATCGCATTGACTTTAGAAGCGGCCATTACAGTTCAT
CGTTTTTGGAACTCATCTACGTTTGACGTCCTGTGGAATTTGTCAGCAAGTCAAATATGCCATTTTATTCATTGAAAATGTCGCTGTATAAAAACAATTG
CCACATATACTTCGTTCATGTTTGAACACTGAACGGTGAATTTGAATTTTTGTAATCGAAATGCCAAGTTGGACTTCGAGACGCTAAATAACATGATTCA
AGTCACTACCATTACTCCCATCGAATTGATTGGCCCTCAATGATATCAATTACCTTTGGTCACGCGATAGCGTCTCGATTTTGCATCCACATGAACCAAA
CAACGCCAACACCAGATCAATTGTTCGCCTTCTGGGTGTAAAGGACGCACCACATTCATCTAGCAAAGTTCAAACAATTCGAGCAATGCATTGGATGTTT
GATCAAACCTATAAATCGATTTTTGACTCGTGAAATGAGTCAAATAACATAACGTAAAGAATACAGTCTAATGACCACAATCGGTGGGGTTGGTGACGTA
TGGATTAGCTGGTACCTAATGAACTTTGGCTCGCTCACAACATATGACGTTACTGGGCGCTCTGGCTCTTTCTCGAAAAAGTTTAATATAGCCCCATTAT
CGCGCAGCAGAATACGACAGGAGAGCTTACACATCTAGCTAAAGCGTATTCCTGTAACTTTTCTTTGTCAATATTCTTTTGTCCAAGAAGGGAGAAGTCA
CAAACACTTGGTTCATTCAGAATGAAATTACTGCAGCGTTGGTACCTGTATATAAAGTGCGGTGCCAGCTTTGACGAATTTATAGAAACATGTCTTGAGT
GTGAGTAGCGCATGTCTTGTCTATCACAAATTGCTGCGACTATTCATCTAGCAGTATGCCTAGAGCATTTTACAGATTGTAGTATAAATTATAAAGCGTT
AAGAGCTATCGGTGCTCAAACACATCTATCAGCGAAAACTTAAACACTTTCATGTCCAGATACAACACATAAACTTGACTTCATCCTTCAGCGTAACCAG
GCAGCTGCGTGATGTTCGGATGCACAAAAGCCTGAAACTCCTCCCTAGCGAATTGCATTCATTCGTTCTTCCAGCATGAATGCTCTCCATAGCAAAATCC
TTGTCCGATCACAAATGACTGTGGCACTATTCAGCCGTAATTGACAACATGAAGTCTAGGCACGTACGACTTTAGTATCTTTATCATTACGACCACAAAT
TCGAAGGTCACAAGGTGATGATTTGTTGTCCGTTTGATAAAGATTCGGTTCTCCAAAAGCCAATGGTATGCCCATCATACTTTTCGGTTTAGATGATTGC
CCTTTAGTAAAGGCAGGCTCCATGTGCTAGCAAATCTTTAGTCTGCTCTCGTTTTTTTTTTGTAATTTACAAGCCGTTGAATCGAAGTCATTCTCATTTA
CAATTAGTCAATGTCATTATCATGAACTACAAAGAAGACTTTGTGAAGCAGCAATGTCCACACGAAGCACGGTACCACCGTAGACCTGCATCATGGCGTG
TCGTAGCGTGCACTATTGTGTGTACCGTGCTCATTGTGACCGAAGTGATAAACTTGTCCAACTACACGTTTCATCTTCACTCGCATATCGCGAAGCACCA
AATTT