Description :
Non Conding Region
Location :
Scaffold_1:46210- 46449
Sequence
239 bases(100 bases per row)
GGCGAGCAGTGGTGTCGTGATTGGGAATGGCAGACCAGTGAAAAAAAAGTGACAAGCATGCGCAAAGGCACGCATTTGTGTGGACTGTGGTGTACTCCTG
CCACCAGTGGCTACTGTACCGATGGCTTGTGGCACAAGTAATATGCATCATTCAAGGTTTATTAATAAACCTTTTATAATTGTTGCATAAACCTCTATAC
GTGTTGCATTTCAATGGCAGATGGTAACGTGTGTTGTAT