Description :
Non Conding Region
Location :
Scaffold_1:46210- 47468
Sequence
1258 bases(100 bases per row)
GAGGACAAGCCATCTTTTCATCGTTCTCCATTATCACTTTAGCTGACTCGTTTGATTCTGCTGATTAGAACATCCTGCTGGGCAACGACGGACACATCCG
GGTGACGGATTTTGGGGTCGCACAACGAGGTGATCCTATGAGTAGTGCAGACACGGATGCTGCAAGCACCACCAAGTTTCAATCCTTTCGTCAGTATGGA
GTCGATGACCGCGTGCGTCTCCGTTCGAACTCGTTTGTGGGCACGATAGACTACATGCCACCCGAGATGATCCTCCAGAAATTGCACCAGAGCACAGACC
TGGATTGGTGGGCACTAGGCTGCTTGCTCTACGAGCTGCTCTTCGGTTCTCCACCGTTCCGAGACAATGAGGAGCAAGAAACACAAGATAACCAAAGCGA
TCCTGTGATGCTGTTTAAGGAGATTATGAAGTGTCAAGTGTCCTTCCCAGCGACGCCGAAAGTGAGTGACGCGTCCAAGGATTTGATACGCAGGTTGCTC
GTGAAAGATCCGCGAAAGCGTTTGGGCCATCGAGTTGGCGCTGGCGAGATCAAGCAACACACCTGCTTTAAAGGAATCGAGTGGGCTTTACTCGGCCACA
TGGAGCCACCTGTGGCCATCACGTGCTCAGAGACGTTGTGCTTCCAGCGATTCCGTCCAGAGAATCTCTGTGATGATACCGCACGCGAACTTATCTGCTT
TGAGAAGCACCTCGGGTTCTCTACGTCCACAGAACTAACTCGAGCTTCTGCTGCAATGAGACAGTGGACTTTTTACCGCGAAAAAAATCAAGTTGGCAAG
AGTGACGATGAGGACTGCAACCAGCTTCAGATGGTCTCAACTCCATCGTCGACCTCGAGCAGTGACACGTTGGACGAGGATATGGACAGGTTCCTTGACG
ATCAGAGCCTCGTGTCGTGTCAATGCGTCTTCCATGGTTCCGTCAGGTTGTACCAGCGCAAAGCGATGCCAGTAGCCATCGACGCGTCCAGATCCTTCAA
GGATGCTTTACGCCACCTCAGCGATTCTTTTCGTCAGCCATCATCTCATGGTTCGAAGGAAGTTGCGGTTTCGCCATTTTCACCAAAGATGAACGCCACC
AAGGATGCCCTGAAGGCTTGGAATACGTTCACAGACCGAGCCACGGCATTTCTAAGTGACCGCCGTTCAGCTTTGAGCAAAGCCTAGTCTTTCAACTGAA
TCTAAGAACGTATTTATTGAACAAAATTGTGAACAGTCAATAGGAACAAGCAAGTGAT