Description :
Non Conding Region
Location :
Scaffold_1:46027- 47505
Sequence
1478 bases(100 bases per row)
tttgtcgcgatggaaaacaatagcgcagcactcgatagacaccacgaagaattcatcacctatttgtcattttgatccaaagtcgaaaagctccaaaggt
gatcgtctaaaagagcagaagtggctctgctggtggcgcctcctgacgtctggagctcttgtccttcttctttttgctcttctcgttgttcttactggaa
ctgctcttcttgtggctactgctcttcttgctagacgagctccgatgatgatgacgagtctcctgctcttcagactcctgttcttcatcgctaaagccgc
cgatcagagaaccctcctgtttccgagaagactttttggacttggtgctcttggatgactcctttttcttgcgcttcttgtcctcatcctcaccacgaga
cgattttttgtgcttggagctcttcttcttcgtctttttgccttcttccgtcgactttacaggtgtctggcgatggaaccactggtcagtggggaccttc
tcgttttcgcccagaggaacactcagatcgacagcagatagatccgtttcctgcaaaatttaggcacaagggttacaagtgagccacaggataatttagt
aaaactaacaaaaaaaaacacgtacttcttcacccattgatccacgtttctttcgagaacgtcgacgatcttcgtcacttgaacgagcaccttcaggcat
taactcgtcctccaaaatatcacgagatttggatttctgtaaggggattcacaagtgctaacgctattacaacacttcgagataaatgaattctgacagc
ttaccttcgaggacttcttcttcttgccgttcgttcctaaagcgcccatcatatccgcaaaaccctgtcacaagaaacgttagcggactcatcccagaac
gcaacttttccgtcctatagttccgtaccgcgttggctccagcatcaccagcggtttgagacccgccggacaagtagaacgggtctttccgcagtcgctc
ctgctcgcgcgcgtactcgcgctctttcctttctttctcatcagcagagttctccgattcagattctgattccgactcggacgaggacgagccatggtga
cgacggtgacggtcgtgcttgtgtccaggcttccgctccggcgagccgtcgccaatgccactgtagccgccaccgatcccagcgtggccttggctaacaa
aggagacttcaaggtcatcctcactcccaaatgccgacacgtctccgcctgactccagaaatttggcttccgaattactcaaaggttcatccagatccag
atctccgggtagtggcaccttgcgctgagccttcactccaaccggagctaaccgctcaacaaagtacgagttcagcacatccagacgttttgcagggtcc
aaggtggcactaccgtcgaaggcgcgttcagtgcgctcctgtgccgtgagagcccccagtcccatgctcaacgccaat