Description :
Non Conding Region
Location :
Scaffold_1:45985- 46031
Sequence
46 bases(100 bases per row)
ATACTAGTTGATTCCAAGGTGCTATCGTCTATTCAGAGTATCATGT