Description :
Non Conding Region
Location :
Scaffold_1:45984- 46168
Sequence
184 bases(100 bases per row)
TATCTTCTTCGCCCTCCTTTTCTACTGCAGCCGTATCTCGAGTGGGAAGTACGATGCGTGATCGCATATAAAGAACTGAAGTCGCTGGCAAGCAACTTGG
AAACCCTCAATGAGTGATAACTGAGAACAATAGCATATTTCTTCTTCAGAGGCTCGCTCACCCTTCAAAGACCATCTTATTCAT