Description :
Non Conding Region
Location :
Scaffold_1:45707- 46651
Sequence
944 bases(100 bases per row)
GTGGCTCAGGCTTTGAGACCACAGAGGATTCAGGTAGTCCAATCCTACCCGCGTAGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGCACACA
GCACCTTGCACAGAGGAAGTGCTAGAGAGCGTAAGCTCTCGGTGAACAACAAGTTCACGGTTCCCGGTCTAAGGGAACCGACTACGACTTAGACGGTAGG
TCTAAAGACTGAATATATCTTATAGGTGAGCCAAGCTTGATCCTTACAATCTCTAAGTCAACTATAGTAAAAGCTAAACAAGTGCCCAATGGTTGGCTCA
CCGCCAACCGGTACCACGTACCATGGGCACAAAAGAGAGACATCCCGTCACTCTTTATGTAACATGGGTACACGTCGGTGTACCCCGTTATACCGGGTCT
CGGTTGACATCAGACTTCACGGTTGCCACCGTTGAGTCTGGCCTCCGATACAAATTCCAACATAGACGTCGTATACGGGCCACAACCCGCCATCTAAAGT
CGTCCGCGTAGGTCATGATGCAGCGACAATTGTGTGAATGGTTCTGGCGTGTTGGTGGCGGGCTGAAGCAGGTATTCCACTCATTTATACCGTTCAAAAG
CGGCAAGACGGAAGATTGTCTCTACAACAGGCAGAACAAACCTACTCCTTTGCTACATTTCGGACTTGGTCGTTGCTATCTCGGAGCTTATCTCTATTTC
GGAACCCCTATCTCGGGATAGGAGACCTCAAGTTTGCCAAAATGGATGAACACCACAATAATACGTAGGAGTGTAAATCTGAGTCATGAGCTATAATACA
AACGAAATAGGGTGCTTCGCACCATTGATTGGCCAAAACCTTTTCCGACATTAAGGTTTTGACCAATCATATGCTGAAATTTACCTGGAGCGACGTTTAT
TTCGTTGGCGCCATTTTCATTAGAATAAGAACAAGCTCCACCCA