Description :
Non Conding Region
Location :
Scaffold_1:45691- 46771
Sequence
1080 bases(100 bases per row)
GTACTGGTCTGCAAATAGCGGAATGTCACCGAGCTCCCGCGCGGAAGCTCCTGTCAGCCTGGAAGTCCTACGTCTGTTACCTGCGATGCGCTTTGCCCAA
TGACGACGCGACAACGAGCGTGACCTAGGTACCCTAGTGGATTCTTTTTTGATTACCTACACCTTGGAAATGCAGGTTTCTACAAGCAGTGATAATATGG
AAAGGGGAGTAGTGATGTGAGCGTCTTTAGACGGGAAATTTGTATTCACAGGTTTTGTGGCGCATCATCTGGTTCTAAAAAACGGGAAAAAAGAGACGAA
ATTTAACTTTCCTTTCAAAAGGTGAGCTTCAACTGAATTTCGAGTAAATCGGTGACATCTTGTTCGTGAGACGGCCTTGTGCTGGATTATTATCGTGGCG
CACCGCAAATGAAATGGCAGAATTTTGGCTCGTTCGTTGATGCCACGTGGATGGTCTTGACGCCAACGGTGATCATTCCCGACGAACAACGCAACGAATG
TGGGTTCAATTAGTGTCCATTTACTAGTGTAAttgttgctccagcagatcgGATCTGGGCGCGGTGCCAATGCTGTGCTTCTGCGTGTGACTTGCGATAt
cagatggagctggcaacCTGCCCCGCCTGAGCTCTGCTGCGGTTGATTAGAAGACCGCAGCCCAGCTCGCTTCCAAAGGCCTTGTCCGTTTTGGCTTGAA
TCATCGATTGATTCGTTTGTTGATTCCTGGCAGGAGACGCGATGGGGAACTTGACCTTTTCGGTTACAGCTttggagctcgtggctggTGTTCGATCACA
GACCACATTGAGATAGCCTCGAATCGAGCTACAACGCCGCATGACACTTTGCTCTATACTATTGTAGAGAACGTTCTAAGTTATACATATTGTGGACAGC
AGTGGAGTTACTATTGCTAGTCGTGGTTCATCTTCTTTAGTGATTCAATATGTTCGCCTTGATAACTGAGACCTCCTTCTATTGGTCAAAACCTATGTTT
TAAACCATctattggctgaaaatgctATATAAGGGGAGCGGTCCAAGTTCAATCATCTCGGCGAACGCCTACGTCGACCA