Description :
Non Conding Region
Location :
Scaffold_1:45502- 45677
Sequence
175 bases(100 bases per row)
CTCAACCATGATAGGAATAATCTGGTGATCCACGCGCTTACATTCTTGCAGCTTGCGGACATACAGATGTAGCCATGTTGTATCATTGATATAGACACTT
TTTATCATGTTGGAGAGGGTTAGAAGTACGCAATAGCTTTGCTAGCAATTATTACTAACAGAGCTTCCAGGACAA