Description :
Non Conding Region
Location :
Scaffold_1:4550- 5084
Sequence
534 bases(100 bases per row)
CTATGCTAACCAGTAGTAAAATAATCCAACAGTAACACAACAACGCGTAATTTGCCCAGAGGATGTATGGCTACGTGTTCAGCTTGAAAGCCTTGAAATC
ACTCGAGCATTGGCCTCCGGACTGGACAGCCGCGTGCCTTCGCGCGCGCGAACGCTAACGACGCCTGTCCTGTGTGACACCGAGCTCCAGAGCGTCTCCC
CATGCAGGCTTTCGCCGCCGTCGGCAGACACCTTCGCGCTGTCGTAGTATACAGCACGTTTGCGCTGTTCGATGGTAAGTTTTCATGGCGGGGGTTTCAA
TGAATGAAACTTTCAAATGCATCGGCGTGTTCCAGGCGCACGCGATGCCTGTGCGACCAAAGGCGGGAAGCAGTCAGCGTCGTGCTCCTTTGAAATTGGG
GAGTAGCTGTTACAGCTTACGAGCACGCCACCGCTGGATACCCGCTTCATTTCGGGCCGGAGCTGCTCGCTGTCCATGGCCACTTCTCCATTTGCACTCA
ACCGCGCAAAGCACACCGATCCCAATCAAGGCCA