Description :
Non Conding Region
Location :
scaffold_1:45234- 46224
Sequence
990 bases(100 bases per row)
TGATATCACAACAGAGTTCATTTCGTCCGCTGAAGATCTCGAAAATTTGAAGAAACGAGAGCAGGCAAATGCGCCGGAGCTATGGCTTCGTCACGTTCGG
CAGTATTATAGCGTTGTGAAGGTGCCATCCGGTCCAGTGGCAGGCGATGACGTGCTGAATATGAAAGGAAAAGTGGTGAAGCTGGCAGCACTCCTGTCGG
AAATCGTGTTTGTTCAGTGTATGGTGTTCTGCAACGATAAGTTTCGTGCCGAGGCGCTAGCTGCAGCTCTCACAGCGCAGGGTTGGCCAGCAGCATGTAT
CACTGGATCTCAGACTCAAGCTACCCGATTGGAAGTGATGGAAGGATTTCGAGCCTCGCGCTCTCGTGTATTGGTGTCGACGGACCTCACTGCGCGAGGA
ATTGACGTTGACAAAGTAAACTTTGTGGTAAGTTAGGAGGAATTTAACTGTGCTCAAGAATTTTTTTTTCTCATTGTCATGTTATGAAATCATAGGTTAA
CTTGGACTTGCCGCGGGACCCAGCAACATACTTGCATCGTGTTGGAAGAACTGGCCGCTTTGGTGGGAAGGGATTAGCCGTGACGTTGCTTTCGAGAAAA
GAAGTTCAAGGCATTCAGCTTCTTGCTCAAGTTTTTAAAATGGAGATTAACGAGTTGCCAAGTCCAGTACCTCCAGAGATTTACACCTATGCAGCTGCAG
AGGGAAGTGGTGACGCTTACAAAGCAACAGATCCTACACTGGTTGCAAAGGAACCGGACAACTACGCAGTTGATGATGAGGAAGGACATAGGTCTACAGA
AAATGAGGTCACGGAGACATTGAAAGCCGACAATGCTGAGGTATTAAGTGAAGTCGAGGCGAGAAGCTTGGTATGTGTTGAGAAAGAAGCGGCGGTGGAG
CAACCAGTGAGAGAGACTTCCAGTCGATATGCCTTAGAAGAAAGATCATACGAAAGCTGGGTTAAGTTACTGTAGTTTTGCCCTACAATT