Description :
Non Conding Region
Location :
Scaffold_1:45016- 45261
Sequence
245 bases(100 bases per row)
acaaaacacagatttacttgtattaatactggtgttcttgaaattgcatagactggacgtcgaacatcattggccctcagtcattttggcagcaaaagag
cacgacaccaaccggcaagcaatacgttcggctctcggtctctagacaatctcgtgcttgctttagctcttctttctccacgctattagcaagtccagac
gcttgcaatcttttctatccaagaatcaccttcagaatccgacta