Description :
Non Conding Region
Location :
scaffold_1:44939- 44987
Sequence
48 bases(100 bases per row)
CGAGCAAGGCCTCCGCCGGCCCTCCTCGACCGTAATGGGGAAACCCAC