Description :
Non Conding Region
Location :
Scaffold_1:44734- 46668
Sequence
1934 bases(100 bases per row)
CTCTTCGAGGGCTTCTCTTCTTGCGTGTTGAGTCTCGTTGTTCCAGTTCGGAACTGGCGCCGAGGAGACTGGACGGGAGGAAGCGTGTGTCTGTGCGTGT
GCCGCCTCGGCGGGGGATGAGATTTGGCGTAATGTTAGTGGACAGGCCGCAGCCACGAGTCACTGCACCCGGCCAGTCCACTGATGTTGTGGGGACTGGC
ACGCAGTCCACTGAAAAGAATTATCTTCGTGGGCCGGAGCCAACGAGAAGCAGGCGCCGGGATGTGAAGGGAGAAGGCCCGTTTCTGCCTGGTTCTCTAT
CATCTCCCCGCGCTCTGATTGGGCAGGTTAAAGTCTCATCACAAAACGACTTGCTGGGAAGACCCAGACGATTAGGGGTTCAAGGAAGGAGTGATGGTAA
AGTCAGTGTGAAACGAAGAGACAAGCTGACCGCTGGATTGGCAACGTATCCAAGATAAGAGGCTCTTAGGAACGGAAAATGCGTCAAGTGTGCTGTACAG
AAACCCGCAACTATGCGTTATCAGAGGTTACCGCACCGCTTCTTCAACGCTGGTGCCGTCAGCAAAAGGTTGCTTGGTCGAGTCAAACACTCCGTTTTCA
GCCAATGGAAACATTGGGCGTTTCAGCTCCGTCAGCACACCGATGGTTTCTCGGCGGAATCCCGAGTGGCGCATGGGCCCCATCATCCATCATTGATGGA
CTCCTCCTACACAGCCCAAGCAAGGGTGCGCCGCACTATGGTACATACGTAGGTGGCGACATGAAACGTTGGTGCTTGGGCTCTGGATCTGCTTCTGTGC
TGTCGACGAACACGCGGATCGCCTCGCTCGTTGAGGTTGACCGTGACCTTAATGAACGGCCACCGCTCAAGTGACTGCAGTTGCCTTCACCGTGTGGGGT
GGCCCACGCAGGCTATCCCCACCAATTTTTCTGCACCGTTGCACACAAAAAATTGGTGGACTTCATTTGGGAAGTGCANNNNNNNNNNTGGCCCACGCAG
GCTATCCGCACCAATTTTTCTGCACTGTTGCACACAAAAAGTTGCTGGACTTCATTTGGGAAGTGCAACACGCGGTAACAGTCGTAATTGGCGTGGCCCA
CCTTATTCTCGACAAAACTTGTTTTCGACACTCTTCTCGGAAACATCAAATATGACAGTGCCTCCAAGTTTAATACAATAAATAACGTCCTGGGCCGTAA
ATAACGCGATGCGGACAAACTCCAGGACACCACGGAGGCCTCCTATGGCGACCACACCACTGTCCTTACATACATGTGCAGTTGCTTCATTGAAGCCGCA
CAATCGCCAGCATACTGCCCTCTTCACGGTCTTCAAGCTTCGCGCAATCCAGTCAGCGCCACATTTGTTTGCGCCACTTGGAGCCGACCCCGCCAGCGCC
AAAGGGTCATCGAACGGGGCAACGCAAACGCTGACTTTCAAGACGCACCGCCCTTTTCGTTAGTCGTCGTCCGGCAAGCGGAGACCGTCGCAGGGCTGAT
CCACTTGATCGCCAGGACGTTACTGCATAGTATTACTGTCCATGGAGTGATCGCCTCTCCCGTCCGGCCCGTCCCTTGGCGTGTGAACAGCGAATTCGGC
TCTTCACACGTCACAGATTCTCGCCTTGCATCTGTCCAGCGCCGACACTCCTTTCCCTCTGACGACAGTGTGGTGGTGCCGCCCGCATTTCATCCAATCA
AATGGACGCATCCGTCTCGTCCTCATCGCTCATTCGCTAAAATGTATCCCCCAAACAAGCCAGCGCCTCCCTCACCCAAGCGATGGTGGGAAAACCCAGC
GGATTTCCGGCTCTGTCTGTAGAACCGTTCCGAGCTTTTGCTCTCGGGGAACCGTTCTTTCGCATCGTGTTGTTCTCGTAGCTCCTCAGTGGATTCCATA
TTCCGACTGCGTCGACCCGAACGAACTCTCAGCA