Description :
Non Conding Region
Location :
Scaffold_1:44513- 45133
Sequence
620 bases(100 bases per row)
GGTGGAAAAAGCCGCCCGATAACCGATCGGATTGGCGGAAATCCGAATGCGTTTCACGGTCGAGCGTTGACTTGCGCTCAGTATACATCGGGCCGTTATT
TGGCAAGTTCAACCTCGAAAGCTCACGAAAAACATCGTTGATGGTCTCCTCGCCATCGTTGCCACGAAGGTATCCAAGCCGCACAAGACCGAGATTATTA
GCTCGCGCCGGCAAGGACTGTCAAACAATCTGTGCGCAACATTCGCACGCACTGTGACGGCCGCACAGCTGGGCGCCCAATGTGCGGCTCCAAGGAAGGG
CGTTGTCGGCTGTCGGCACTGCACTTTCACTCGCAGGCTCGTGTGATGAACTCCGAGCAATCACGCGGCCACTTCGAGGCTGTCAGCAGCACTGCGCAGC
GAGTGTGGATAACCTTGGCAGCAGACAAACCCAGAGGTACTGAGCGTCCGTCCTGCATTGATTGCAACTCATGACTTTCTGATAACGGATGTTGTCAACC
GCCGCAAATTTAGACATGGCTCCGCTATTTTCactacctgcagcagcaggtgctgcccCTATTGTGGTGTTCAGACAACAGAGCGCAGCTAGCCGTGTCA
AGGTTTTTCGTAAGTCGATA