Description :
Non Conding Region
Location :
Scaffold_1:44492- 44588
Sequence
96 bases(100 bases per row)
GTTGAGGCTACAGTCTTGCCAAATAGCCTGATGTACATGAAGAAGCACAATAGGCGAGCAATTAAAAGCACAGTAATGAAAGGGGTCAATAGCCCC