Description :
Non Conding Region
Location :
scaffold_1:44149- 44262
Sequence
113 bases(100 bases per row)
ACGATCAGTACATCATATGTACTACATTTAGTTAAAGTTCCCGAAATGCCTTCTGTTTCGGTGGCACTAGCCAATCCTACTCAAGCATAAGTGGCACTCC
TGGTCCAAGATAA