Description :
Non Conding Region
Location :
Scaffold_1:44090- 45629
Sequence
1539 bases(100 bases per row)
ACTGCTGCTGGAGTCGGTGGAGGAAGGTGCTTGNNNNNNNNNNTCACTGGGAAGGAAATGAGGGAATGAAGCGCTTGGGAAGCGATTCAAGACAAATGAG
CGAGCGGTATGGGCGGGTCGCTGCGTGGCCATGCGGCATTTTCCTACATCACTACAGTACACAATTGGGCGAGCTGCTGCTATACAATCTACGCCACACG
TGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGGAAAAAGACACGAAGCGCGTGCGCAGTAGAAATGCAGCAGGG
CGTATATGGTGGCGGTGATGGGGATTGGCACAGGATGCCATTCGACCATACAAAATTTCATATAAAAGCGTACTGCAGTGCATACAGAGGAGAAGGCCCT
GCAGAATGGAAATGCAACACCTTTTGGGCCATCATGCTCAAGTTGGCCGACCTCGATTTTAATGCAAATGATATAGTGGCATACCAGCCACTTGGTTGAT
AAATCGTGACTATCAGTGGTTGAATGTTCGTAACATCGAGTCTTCTTTCGGATTTCCGAACCGTCGCGTGTCTAGCAGTACGGTGTCATAGACAAACAGC
ATTGTCACCACCAGAAACCTCCGTAAAGAGATAATAGCTTGGTCCGAACAAATTCGAGAGGGTCAATGTTCCCACCTGCAGCCTTTTATAAAGTTCGATG
TCCTAAACATCCAGTCCTCAGAACCGTACTTTGCTGTGAATGACATCCAGCTTGCACATGCCACAAAAAAAAAGCCAGCAGTGAGTGTTTTGTCCCACAT
CTGGGTAATCCCAAACGTACTTATTTACCTCTACAACTGTATAATGGATTGCCTCAGAATGATCAACGCCAATCAAAACGCTCGAACCTGATCCTTCCAC
AAATAGAAGCGCACTTAACATAAGTCTGCGACATGCGGATGCAGCACAAGTGGGTACACTTTGTTGGTGACAGACACACCATTCGATATTATTTGACACA
CTGCTATTTGTTTACGCGCTGCACGGTGCACGCAGCACCACGCTGCCCCCAAGTACTCCTTTCATACGATCGACGCGCGTCGCTACAGAAACGATGGACG
ACAACAACGCCGACGAGCACAACGAGCAGATCCTGGGTGCTCACTGCCCTTGGAGCGCAACTGAGCACTCCCCCGAGACCACCGCTGCAGCACCAGCAGT
TCACTGGGAGGCGGCTCATTTTGCACACGTGTCACAGCACAACAAAGACGGATACGTGGCGGTATTTTCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CGAGATGCAGCTGGGAAAAGAAAATCCAATGCGCTGTGTGACATCCGACGCCGTGGTACTGGCGCTATCAGTAGCAGCAGCTCAGACCTCGCGCTGTCAA
ACTCCTGCTCCTGCGGCAACTATAGGACGACGGCATCAAGGGCCAGAAGAGCAGGAAAGGGAGCAAGCAGCAGCAGCGCGTGCTTCCGAACCAAGCAGAA
CTATGGACACCAGCGCCATTGAAAGCTGTACAAGCACCA