Description :
Non Conding Region
Location :
Scaffold_1:43795- 48213
Sequence
4418 bases(100 bases per row)
TCGCTGGAGCGTTTGTTTGGTTGGTTGTTTGATTGGGAAAGAAAGAAAGAAACCGCGCCCGCAAGAGAGAGTTTCAGTCCAGCGGGCAGCTGTTTCTGGG
CATCGGGAAAAGAGCCGGCGTGGTATGCGGCTCAGGCCGTCCGTGCTAGCTGTAAAGGGACGAAGAAAGGCAGACGTGGATGGTCCCTTTTCGTTGACGC
TCTCGTATTTGGTCAACGACAAAGGGGTGAGTTCTAATAACCGCGTAGTAAAGGACTAAATGTGGAAATTTTGGCTCAAAATGGGAATCGCCGTGGTGGA
ATAGCATGGCACGACATGGCGAATATCTTCTGCGTAGGATCTTGCTCCTTTGAAAGCTAGCACGCCACTGCCAAGATGCCGCCGATTGTCCAACAAAGGA
GACTGTGCAGAGACTCTCTGGGGATAGTGCCAGTTGCTGCACCCTTCTTGGCCGCCAGAGGGACGATGGTAGTGGGCCTGCAATGACTGCCGCCTGGTTG
TAGTTGTGTCGCGTCGGCATCTGGTGGGCGGTTAAAAAGTAGTGCACGTGGTGGCCGCGGCGTTTGAAGCGGCGTTTCGACGACAGGGATATGATTGCCA
GCTTTGCTTTGGCAGACGTCTGCTAGTGCAAGCCAGAAGTGGAAAATCCACACATGTTTGGTGTCAAAACAGTCCTGTTGACGACGATGGGTCATTACTG
CTGCTCAGCGCTGCTTTGCTGATTCGTGGAGCGTGGTAAACTCCTGCCAGTCGTCATGATGACAAAAGACTTGCAAGATGTACTCATTGCCTGGTACCGA
TCGAGTCGACCGCCACAAGACCGGCAGTGTTGCACGCCATATTTGCCACCAACGCGTGCAAAGCGCACTGAGACATTATCCGGTCTTCGGTGGAGTGGAG
CAAGAACAGCGTCGATACGTTGCTCGAACGATCTCGGACAGTCAGAAAAATGATTACTGAAACTGCTTGTGGCCACGACGTTGCAAATGGAGCAGCCATG
TTTGCAACATGTAACTACCCCGCGAGTTGCGTTCAATTAATTTCTTTGGCGCTGAGCGAGGCGTACCACGACTTGATCTACTGGACAAGTTGTTGATCCA
TTACTCGCACCGTAGCTCACCATGAAACACCGTGTAAGTAACGTTCCGTAGGCGCATGGCTAATGCAGGACATTGGCACAGTTCCTGCGCCCGCACTAGC
TCCACGTCGAACTGCACATATCCACGTTTTTGTAGGGGCTGATTTGCAACAGTGATCCACGTTATTGAACGAAAGCCTGTTTACTGAGGTAGTCCAAGTC
TGATCACATGTTGGTATGAATCAGTCACGTTTGCACGGCTGTCCTCGCGGTGACGGACTGGTGCAACTTGCGTCCAGCAAAACCGCGTCAAGTTACCAGC
AAGACCTCATTTCACCTAGTTTGTTGAATTTGGTCGAGCGCCACGCAAACGTAGACAGACTTGTCACGGCAAGTTTGCTCGTCTGAATGGCGAGCATAAG
TCTTACTTGCTTCGTCTGTACCGTGGCTCTACGGTAACGTATCCCCTAGCAGCCACAGCTCGTACTACGACACTGCATCCTACTATAAGTATGCCGGTGG
TATGCCGTGTGCTGCAACTACAGTGTGCAGCATCTGCGACTGGCAAGTAGCGAGCTGCACGCCGCAAAACACATCCATCATTACCGGCGGACTAGTCTGG
AGTGCGACATGCACTTATCTCGTGGCTCTGGATTCTTGAAGCGCTCGATGCTTGAAGTGCACGACAAGTGGGGGCAACGGGTATAGGCAGGTGTACTCAC
TTGGTCTCTAGTTGTCTGCGGTGAATGTGAGTAAAAGCGGGTTGGATTGTGTAGCTTCAAGATATGCAAGCTTCAGTTTATGGATAGGTCCTTATAGTGT
CGCATAGCTGGCATTGGGAACCTGCCCTTCAGAATGCTGCTGCTGAAGTGAATGTCTTCATGGCACCAAATGGCAGAAGTAGCACGTATGAGTCTTTGGG
CGTGAAATGGATCAGCGTCTTGTTCCGTTCTACGAAGTAACTGACGCGTACGATGCTCCGCAGACGTTGAGTCGCAGTCCCTTTGCTTAGCTGTGTACAG
GAATGGAACTGTTTCATTGTTCGCTGGCAATAGCAACAGATCAGCTCATAACAAGTACACGCTTTGACTAACACTCAGCCTTCGTAAGGTACAAAACTAG
CGACGAACTGTCGTAACAACAGAGCGTGTTGAAATTAGTCCGTTCTGCTATTTGCAGCGCACTTCGAGCACACCCAGCACAAATTTGAAGAGGCAAGGAA
GAGCCGTAATGCCGTGCTTAAGTCAGCCGACCTGCACGGGACGACTTGCAGCTTACGACTTCTCACGCTGACCGTTGTTGTCGCAGCGCACGGCTGCTCG
CATCACTTCTAGACAAACTAGAGCCATCTGCTAAACCATTTTGTTTCGGCGAAAGCCGCATATTTATCACGTCACAGGCGCGACTTTTGGCTTAGCTGTG
GGACAAACGCCACTGATACAGGCGCGGGTCAAGCGCGACCCGTGTCCGCCACATCGGACACGCAAATGTAATCGGGTATGCCGATAGACGTGTGGCAACG
GTGAGAAAAAGGCGGATCAAAAGGTTGCTGACGACTTGCGCTGAACGCAAGTCGTAACAGTCCTTCCGCCGCGACGACAGCAAATTCGTGTCATACAGGA
TCGAGCGTGGACTGGCTCGCTGGAAACTCGCTCGATCATTAAGCTCACGCATAAACGTCAAACGTGGGTGCTAATTTTTACTGTCTCGCGATGTTAGAGT
GACATGCAAACGTCGTGACGATATGTAGTATCTATAAAGTGACAGTGTGAAAAACTTGAAGCAACATGTATGCAGCTTGGAGCGGGTGGCTACATTATGA
TTCCAGCGACCTCATAGTGGCGACCGATCGCACACCGTGGTCGGCAAAATTGATTCAATACCGGGTGATGCAGAACTCTGCAATTTGTTTGCATCTTCGT
CATTTTTGGGGAGTCTAATGGAAGCAGTTCTCCAATACGCCTCTTACGTTTTGAAGTTGACGCACGACGAGATCAATCGCATGAGCAGCAATGCAGTCAA
CATATGGATAGGTACTGCCGCTGCATTAAGAACAAGTGACGCCAGCTACTTCTAGTCAGGGAAGGATCATTATTTGTCACGTAACTATTGTGATATCATC
TGTTACCAGCTGCGATGTCCCCCCACCGATGGATTTGTCCTCCACCTAAGTCAGAGAGCTTTTTTAAGTACTAGTTGTTATTACTTAAAAAAGCTCGAAC
CACACCCGCTACGACTGACAAGAACTTCTACTTGCGGACAAATGACCGCTGTCAGCGAGTGATCTAGTACCAAGTCTTCAACTAGTGTGTGCCGGTGTAA
TGATGGCATGGTGATGTTGGCTAGCAAAAGTGTTTGATGCATTTCTTAAAATCAACAAGCTGCAACGGGTGTTGAAGGCTCCAAGTCGATCGCCAGGGTG
AATAAGGTCGAGCAAACACGAGGAGCGGCGGTTTTTAGTAACTTGAAAGCTGGTAGCAGACACACACGTGCGGTTTGCTCATAATCGAATGCATTCTCTG
TAAAGTTTACGAGCAAATTAATCGGTTTTAGTCAAGATGGCCACTGTCTTATGCACGCTGTGACGAGAACAACTCCACCTGACCGCTGCCATACCTTGTG
ATGTGAGTTGCTAGACAATGGACACGAAAAGTAAATGACGCGCACCAGAACATGCCTAGAAGGTCACGGTTGAACAGCCTTCGGCCTCGGAAAAAATATA
ATTTGGAATTTGATTGATGTAATGGCTGCATTCGTTTAGCTGAGAGAGCAACAACCATAACCTCACGCATAGGCGCGCAAGGACGTGTATATACATACAG
TGCCGCATTATCATTGTTGTCTTACAGGTAGAGGAGTGCCTTTTGGAAGAAGTCAAACTGTCCCAGTTCGGTTCTGTTGGTGAGGACAGCGTCATCAAAA
TGCCGCCACTCGATATACTGTAAAAGAGACGTCGAAAGTTGAAGCAGACACCCATCGCTACTGGAACATGAATGTGAGAATCGTCCTCTTGTTCTGCAGT
GCGAACAAATCGTGTCATTGGGTATGGAAAAAGGATATTGGTGAATGTACATTTGTCAAGGTAAAGCAATTACTTGCATCTACAGCCTTAGTCTGTACCC
GATTTTCCGAACGAGCATCCATGATCGACAAACAACAGAGCAAGCGCTTCTACAGCTACACAACTGCCATCAACTGCGAAAATGTTGTAGATTCGATGAG
TAGCCCGCGTAAAAAGCTTAAACACATGAAGAGTTCAAAGATGGGAATGCCTCCAATCTCGCAGGTTTCATCTCGTAGAAATCGGTGCGCGATACGCATT
TCTCCACCAATGTCAGCT