Description :
Non Conding Region
Location :
Scaffold_1:43660- 95207
Sequence
51547 bases(100 bases per row)
ACATCAATTTATCGCGCACATTTTGTTGATGTCTAAAGCAATATGAGGTGTTCCGAATGAATCATTGTTTTGAAATTTCAAAACAACATTTTACAATAAA
TTATTATTTATTTTTGAGATACCAGATATCACTTTCAATAAATTATTTTCCCACGGTCTTTCCAATATTGTTTTCCGTTTTTTTCCACGTTTTTTAACTT
AAAAATCTTTTTACTGTATATGGAAGGCTTATTTTGGCTGCAATTATTTATTTTCGCTGTTGATTTCAGAAGAACAATATCTTTTTTCTAAGGGCTGTGA
TAATATTATTGCAACGTTATTATCGGAACATCTGAATATGGCCAACTCCGATCGGCTTCCTCCTCTTTGTTTGAAGGTACAGTACCAGGGTCCGGCATAT
TGCCGTAACATATTGAGTGGGGCCTAGTATCAGCGCCAATAAATAATTGAGTTATTTTTATATTTTCCACTGACGTGAACAGACTAGCGTCCTGTCGGCA
CAAGTGTCAAAACGGAGGAACTAGAGGAAGCCGCCACGCGCAACCGCCGCGCATTACCGATTCAAGTACAAATTCATTAGTGACTTTGAATCTATTGTTT
GCTAACTAAACTCGCTGTTTCTTCTTGCTTCTTTCGATAGCTTCAGCTACGACACTAGCATCCCACAAGGTCCTGTTCTGTTGAAGAAACAGCACACTTT
CCAGCGTTGCAGGGTTCATGCCCCGGCGAAGGCGCGAGAAGACGATGCCAGCTCGCGAAAAGAGTCTCTCGACATCGTTCGACGTCGGGGGAATCCACTT
CAGGTCACCACGGCTCGGAGCAGGCTTGTCATTGCTGAGAGCGGCCTCAGCAAAGGGCCTCTTCTCTGTCTGGAGGCCTGGATCGGAGTCAGTAGGAAGA
AGGAGCTTGGCAACAGCAGCCCGTTCAGTGCGTGAAAGTTTTGACTGCTTTCCGGATAGAAGCTTGACCACGCCATTCTCAAAGCCAGGGAACTTGACGA
GACTTGCCGTGGGGGACAACCATGCAGCCGTACCAGGGAAATGCTTAATCACATGATCAAACAGCAGTCGCACGTCGTGTAGCGACAAAGACTCTGTCTG
CAGCTTCTTGTTCACAGCTTCCAGCTTTTGAGGTCCTCATGCAAGGCCTTCAACGTGACATTGTCACGCGCAGTGGGGATCACGTCTGCAAGCGTGTCAT
CGTCAACATGCCCTAGAACTCCGTTGATCTTGAAGTACCTTCAATCAATGAAAAGGTACTGCTCCATCGTGTTGCATTGCGGAAGACTGGCATCAGCACA
CCTAGCTCACGAAGCTGGTGTCGGTTCTTAATAGTGTTCAGCTTCGTCATCAGCAAGTGCAACTTATCCAAGACCTCCGAATGTTCCCGTAGGGTTGCTT
GCATAGCCAGATTGAACCGGTGAGAGGCGCAGCCGATCATCGGGACTCGAGCCTTTCTCGCCACAGCTACATTGACCGACGCATGGTCGCAGACGAAGAA
GCAGAGTTGAGACGCGTCGATAGCAGAAGTGTCCAGTACATCGTCGAGAAGATCAATGATCGAGTTTGAACTCATATCCGACGCATCCGCCAGCGTCGAG
AAGCACAGCAGAAACTTGTCCTCGGGCGTCCAAGCGATGACAGCAATAAAATGCGTGCCGTCTACCGTCCATGCATCGATACCGAAGCCAATTTGCTTTC
CGCACAGCTGCGACTTGATGCGGTCTTCCACAAGCTTTTCAACTCCGGCCATGTGTTTTTTCAGCGACTTCACGCTGACGGGCTTGAGGTTCGTGTCCTT
CCTGGTCTTGCTTTTCTCGCACATGCTCAGCTCCCGATTTTCCATGATGATCCAGTCGTGCCAATGGTACATCGTGAGGGAAAAGTCGTCTGTCTTGACG
AAGACGTCCAGGCTACCCTCTCGTCGCTGAACAGCACGAAACTCGTCCTCGTACGTCCCTCCATGACGGCGGGGGGGGGGGGGGTCGTGTCTCCTCGATT
CCCGCTATTAACTCCCAGAGGTTTTTGAAATCTAAGTCGTAAGTGTTACGACATTGTGAACAAATCACAATTCGGAAAGCCAAAACTTACGACTTTCAGA
CTGCAACGCACATTTGTTTTGTTTGCAACAGATCCCTCCTTTCTAATCCATAAAGATCCGGGCGCATCAAAAACTGTACGAAGATCAAGTAAATGCAGTG
CTACCCAATCCATCTATACGATTGCTGACTGTAGAACATCCTGGTCGACAAGCTCTTCCGCCTCATTATCAGAGTTGCCATCTTGACAAATCAGCTCTCG
TCGCGTGGACTTATGTGCACCCACCTTGCCTGAGCGCCGCAAGACGACGCGTTTCCCGAGGGGTGCTGGGATGGAGACACCACTCTCGAAGTCTGCATGC
AAGATTTGGTAGCATGTCTTTCGTACACCCCGTAATTATGCCGCGATTTGGGGCATAGGAAGCACTTGGCACCAGGCTGTGAACAGTCTTCACAGTAGTA
AGTGGTCTGAAATGACTTCTTTCGCTCGCCGCGGAGAAGAGCGCAAACTTTACAGGAACGTTGACGGCGTTTCTGGACGCCTGATACGATGACCCAGTCG
TCAAACTGCACATGCGCGTGACCATCTAGTCGGCGGCGCTTCGTGGAGCGCGCCATAAGGAGAAGGAGTAGGGAGCAGAGGCGTCGACAAAGTCGTCTGC
CGTGAGCTGCAGTAGTTGTTTGTGCAGGAGGATATACCAGTCTCCACGGTCTTTAGGTTACGAGTCGCTTGGAGCCGACACGTTTCCGTCTGTGTGAGGT
ATGCATTCACCCAGTGCCATGTCTAGCAAACCCCATGAACAGTGATTTGTAGTCTTTCTGGAATCGGAACGCTGTCTGAATCGAATACGACTGGAGGCGG
AGTTGATCATGGACATCAACTCCGCCCATCCCAGCGTTGATAGTCGGTAACGAGCTTCGGGCCTTAAATGTTGACGGTCCTACCATCTTGATGTTTCTAT
AGATTGAGTCTTCTACCATGGTCGGACCCGTTGCTAGGTAGTGTACAGGTTTCCTGTCCCACCAATGACAGGCAATCATGGTCGGAATAGCATCTGACCG
CGAGAACGCGAAGGATCCCCGTTCTATCGCACGCGGTCTTGCTTTGCGTTTCTCAATGACTTGCTTATCAAATCCTAGCCGGTTAATCATGATCGTCCCT
AGCACGTAGACCGACATCGATAAAAGCTGTATGGCCAGCGGTATCGAGGAATAGAACCGGTCGATTACAGCTAATCGAAATCCCGGAGAGGCTTCACTCA
GAACAGCCTTCATGTTTCGTATCACTGCTGCTGCCCTCGTCTTGTTGTCGACCTCTTGTTGGTCCCTATCTTCGGTATCTCGCTTCCCGACGTACACCTC
AAAGCTGTAGTCGCAAATTTACGACATGGAACAAATCAAATAAGAGATTAATTTCGAAATTTTCGACTTATTATTTTTTCATAAAAAAACTCACCGATGA
CAGTACGCACTCTTGGAATCGCACACCATGAATAATTTTGTTCCGTAGCGGTGGGGCTTGTTGGGCATGAAAATCCGTGTTGTGTTTCGCTTCGATGTCG
ACGGTAGAACACCTTCATCAAAAGAGAACGTGCTACCAAGTGTCCAACCCGAGTGAAAACGAGACTGCAACACGTCCACACCGGCCTCAACTTCCACAAA
CTTATCGCGAACGCGCGGGGCCTCATTGTTCACGACATGAAAGTCGCGAAGGATCGAAGTGCACCGGTTGCAAGCCATGAACTTGCCAAAGTTACCGGCT
GATAGTGCGCCACCATCGAATACCGCCCAATGTCGTGAGAAACGCCGCGTCATCGGGTTCAGCATTCTTGCCACTAAAAGCCCCATCACATGTAAGATTT
CATGCGTTTGGTACGCAGGTTTGCCACGAAGACGCCTTTCAATCTGCTTGATAGTCTCTGGCGTCGCAGCATGACGCTTCCGTTGTTTTGCTCGAATTCG
TTTTGCTCTGGCGTGTGCAGTTTGCTGGTTGTAGCGGTTGGTCTCCTTCGTAATGCTAACCCACAGCGACTTTGGCAGATAAAAGGAAAATAGCAGCATC
AGCGAGTCTGCGATGGCTTGGATCTCTGGCGTAGGGGTAGCAACATCAGTAGACAGATGCGCATATGCTTCACAATCACGTTCAAACTCGGACGAGGGTG
CAATCCATGAGAATTGCCGAAGCGCGTTCTTGTCGATATCTTCAAGGGTAACCTTTCCACCCATCGCCTCCACAAAGGCATCGTCCATTAGGGCGACATC
TTCGTCAGGTTCCAGTGAGTCGTCGGGATATTCGCGCCGCTCAATGACCTCATCTCCACTATTATCGCTGTTGTCACTACCGCTCGCTGTTGTCACTACC
GCTCGAATCGATTGCCTCATAGGCGTCCGACACTTCTCCATCCGCCATGATGTTAACGTCGTCCTCCGCTACGGCAACGCGGTCATCCGGAGCATCCTCC
ACACTCTTATAATCATCCACTCTGGCACCGTCGCTCGCGTTACCATTATCGGAGTTGTTAGACTCGGCGCCCGACAAGAGGCGCTGAAAGGCACCGACGA
CCAGCTCGTGATCTGCCTGGTCCAGACGATCCGACTGGGAACCGCTTTCCGATCCGAACATCGCTTGTATTGTGCTGGCTGATAGCGCAATGGATGTGTC
GATCTGCGACGCCGTCACCGACTCGTTCGCTGGCAAGCCCTCATCGACACTCGCCTCTCCCCCACTCTTCACTACTCTCTTCTCCAATAATCCCCGACTC
GATCGCAAACGTCACCACTGCATCCTCGCCTACAAACAACAATTCATTTAGATACCTGTGTTGTGCTTCGTTCATGCGTTGCGTACCGACAAGCGAGATC
CCGGTCGGTGACGTATACGTCCACTCCTTCACGAGTCCGGAGCCTAACGGCCTCTTCGATGTCCACCCCACTCCACGGAGCTGCCGCCACAGATGCTTGA
AGTCGACCGCTCGAACCCCACGCGTGTCTTGAACTACCGACTGCCTGGTTCTCGTACTGGATCGTACCCTTGCCATTGTGGAAAATTCTGGAATGAGACA
CCACTGCTTCGAGTCGGCAGCCTCGACCACTCATCCAAGTGTCCGGACTGACCAGATTGCTGCAACATCTACCCTTCCCACACCTTTCTTTGACATTTTC
GGTTTTGACCTCTTCTAGCTTATATTTTTTGGCAGAAAAAATTGACTTGATTAAAGTATCGTGTCCACTTTGTTCGAGCCATTTCCTATCTAGGGATCCC
AGTAACCTCGTAACTTACGACTTGTGCCCTCCTTGAAGTCGTAAGTTACGACGTTGGTAACGGAGGGGTTAACATTCTATGAAGTGGAATTGCGTGAATT
TGAAATGAATACAATTCTATACTGCGAAGAGCACACGATTGTTACTCTTCAACGGGGGCTATTAATAGTTGTCTTTGAACAACGCCAACGGCGGCTCTAT
ACTGGCTGCTAGACCCATATTTGGCACTGAATATAGAATTGTGCTTGCCAACGGTAATCCTAAAGAGGTTCTAAAATTTAGGATCGACGTGGAATCCGAA
ATATCTGGCTAACTATAGAAGCGAATTTAGCCGCTTCTATCTTTGCAAGGTTACTATACAATCATCCACCTTCCTCGTCAAGATATACTTACCAAAGATA
TCGGGCAAACGCGGCGCAAACTACAAGCTGTCAGAGGACAAGGCATTGTGCAGCAGCTGAATTCAAGTATCAGGAGACGCCAGCATTGGGACCAATCAGT
GTGGTAAGACCTTTTGGGATGCCGTTCGCAGTGCATTTGACGAAGCCATGCGCACCAGCAAGAAATACTATGTTAAAGATAGGGTCGCTAGTTTTGGGCT
TTCTTCACTTCCAAACGATCTCCCGCGACGTGCAGAAATCTGTCGAATGCATTGAGAAAATAAAAGCTCTTAGTCAAAGTGGCGTCTCACTGACAGACCA
GCAACAACAAGCTTTTGAGCTTTATGAAGCGACAGCTGGGTCCAAGTTTCGTTTCGTAGGTTGTTGGTACATTCTGAAAGATTCGGATAAGTGGGGGGCT
TGGCGGTGGGCGACCGAAAAAAGGCATCCACGCCTTCAAAACCAAAACCCTCTTCGCTCGGCAGCGTTCAAGGGGTATCTAACCTTTCAGATCATTGTAT
CGACGACCAAGTAAGAGGCAATGTCGACCTGACGACTGTCAACGAAGATCAAAACCATTCCTCCAAGCGTCATAAAGGTGTATATCGAAGTAAATTAGAT
CAATCTGACCTTGCACTGCTCGCTCGCCAGGTCGCAGCTGCAGAGGAGATGACTAAGCTGTCAAAAGAGCAAATCAAAGTTGCGAAAGAACAAGTCAAAT
TAAATTTGTTCTTTTTTTCAAGCCGATCCAGAGGATGCTACAACGCGTGAGTACCTGAATTTAAAAAGACATTAAGTTCTCAAGCGTATACGCGAAGAGA
CCACCCATGAGCACGATACTACAAATACGCTATCCTCAGCAGATGTGCCAGCTCTAACCGCTGCGGGGGCATACACAAAACGAGCAAGAGCCTCCTGATA
TTACCGACCAAGCGCTCATTTAGCATATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGC
GACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAAAAGTTTAATGTTAG
TCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCT
GCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTG
TAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGAT
CAAACGTTAGCCTAGTACTTGCCTAGTAGCAGTCCTGAACCATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTTTCTAGAGGATCTGTA
AGGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTAAATGATTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATT
GCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATT
CGTACTAGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTG
CGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGCTCAGAAGTTTAATGTTA
GTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCC
TGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTTTCCGTGCTGTG
TAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGAT
CAAACGTTAGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTTCTAGAGGATCTGTAA
AGCAATACAGTACAAGTAGCCCGTGAATGAGAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCTCAGACTGGAGCAGGGCCGATCCCATGGCCATCTTGACCTCACGGGTCCAGAGAAGGAGATTCTCTCCATCCTTCCCCTCGAAGGTTTTTACGCTC
ACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATACACAAAACGAGCAAGAGCCTCCTGATATTACCGACCAAGCGCTCATTTAGCATATTTC
TTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTG
AAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGC
GACAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCATATGCGAAG
GCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAGCGAAACTA
GTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTGGCCTAGTACTTGCCTAGTAGCA
GTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCGTTCTCTAGAGGATCTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAA
AGTTGGATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAGTCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGC
CCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTCGGCTTTACCCAGCGTCTCCCATTT
CTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGTGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTT
GAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAG
CGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCATATGCGAA
GGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAGCGAAACT
AGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTAGCCTAGTACTTGCCTAGTAGC
AGTCCTGAACCATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATCTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGA
AAGTTGAATGACTGCCGACAAAACACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGC
CCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTCGGCTTTACCCAGCGTCTCCCATTT
CTTGACCACTAGCTCGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTT
GAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAG
CGGCAGAGTGATCCATTGATCCGTAATTAAGCTCCAAAGCTCCAACAAAAACCAAATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCATATGCGAA
GGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAGCGAAACT
AGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCCGGGGATCTGTCGATCAAACGTTGGCCTAGTACTTGCCTAGTAG
CAGTCCTGAACCATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATCTGTAAAGCAAATACAGTACAAGTAGCTCGTGCT
GAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGGAGA
GGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCAATTCGTACTCGGCTTTACCCAGCGTCTCCCA
TTTCTTGACCACTAGCTTGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCTCA
CTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATATTAGTCCAGACTTGGCGAAAGGCACTTGCGA
TAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCATATGC
GAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAGCGAA
ACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTGGCCTAGTACTTGCCTAGT
AGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATCTGTAAAGCAATACAGTACAAGTAGCTCGTGC
TGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTACTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGGAG
AGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTAGGCTTTACCCAGCGTCTCCC
ATTTCTTGACCACTAGCTCGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCTC
ACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGCTCAGAAGTTTAATGTTAGTCCAGACTTGGCGAAAGGCACTTGCG
ATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCATATG
CGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAGCGA
AACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCATCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTAGCCTAGTACTTGCCTAG
TAGCAGTCCTGAACCATCGCCTGGACGTAAAGATAACTCCGACAGAAACTGCTCCATTTTCTAGAGGATCTGTAAGGCAATACAGTACAAGTAGCTCGTG
CTGAAAGTTAAATGATTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGGA
GAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTAGGCTTTACCCAGCGTCTCC
CATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCT
CACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCCAGACTTGGCGAAAGGCACTTGC
GATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGACAATAAAACGCCGTGCATAT
GCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAGCG
AAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTGGCCTAGTACTTGCCTA
GTAGCAGTCCTGAACCATCGCCTGGACGTAAAGATAATTCCGACAGGAACTGCTCCATTCTCTAGAGAATCTGTAAAGCAATACAGTACAAGTAGCTCGT
GCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGG
AGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTGGGCTTTACCCAGCGTCTC
CCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGC
TCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAAAAGTTTAATGTTAGTCCAGACTTGGCGAAAGGCACTTG
CGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAACCCAAATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCATA
TGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAGC
GAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTAGCCTAGTACTTGCCT
AGTAGCAGTCCTGAACCATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTTTCTAGAGGATCTGTAAAGCAATACAGTACAAGTAGCTCG
TGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTACTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCG
GAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCCTCACATCTTTTTAGTCTCTGTGACCAATTCGTACTCGGCTTTACCCAGCGTCT
CCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCG
CTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCCAGACTTAGCGAAAGGCACTT
GCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCAT
ATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCCCGCCAATGGTACCGAG
CGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTGGCCTAGTACTTGCC
TAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATCTGTAAAGCAATACAGTACAAGTAGCTC
GTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTC
GGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCAATTCGTACTCGGCTTTACCCAGCGTC
TCCCATTTCTTGACCACTAGCTTGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGATGTAATATAGCTGCGACTGAATGATTCCTTGGTAGC
GCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGAAGTTCAGAAGTTTAATGTTAGTCCAGACTTAGCGAAAGGCACT
TGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCA
TATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGA
GCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTAGCCTAGTACTTGC
CTAGTAGCAGTCCTGAACCATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGAATCTGTAAAGCAATACAGTACAAGTAGCT
CGTGCTGAAAGTTAAATGATTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCT
CGGAGAGGTCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTCGGCTTTACCCAGCGT
CTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCTTTGGTAG
CGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCCAGACTTGGCGAAAGGCAC
TTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACTAAAACCCAAATCACATTTTGGCCCTGCAGACAGTAAAACGCCGTG
CATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACC
GAAGCGAAACCTAGGTGTCCTTCCCGCCAAAGGGATCAATATAAGTACCATCCGTCAACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTAGCCTA
GTACTTGCCTAGTAGCAGTCTTGAATAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGAATCTGTAAAGCAATACAGTAC
AAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTG
CACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCATATCTTTTTAGTCTCTGTGACCGATTCGTACTCGGCTTTA
CCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTC
CTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAAACGTTTAATGTTAGTCCAGACTTGGCG
AAAGGCACTTGCGATAGCGGCAGCGTGATCCATTAGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCGTGTCAGACAGTA
AAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGC
CAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTGG
CCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATCTGTAAAGCAATACA
GTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCC
TGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTAGGC
TTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGATAATATAGCTGCGACTGAATG
ATTCTTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAAAAGTTTAATGTTAGTCCAGACTT
GGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAGTTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGACAGT
AAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACG
CCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTG
GCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATCTGTAAAGCAATAC
AGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTACTGGTGAAATTGCTCAAGCC
CTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTCGG
CTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAAT
GATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCCAGACT
TGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGACAG
TAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCAC
GCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTT
AGCCTAGTACTTGCCTAGTAGCAGTCCTGAACCATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATCTGTAAAGCAATA
CAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAT
CCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTC
GGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACAGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGA
ATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCCAGA
CTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGAC
AGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGC
ACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACG
TTGGCCTAGTACTTGCATAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGAATCTGTAAAGCAA
TACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTACTGGTGAAATTGCTCAA
GCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACT
AGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTG
AATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCCAG
ACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCAGA
CAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACG
CACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAAC
GTTAGCCTAGTACTTGCCTAGTAACAGTCCTGAACCATCGCCTGGACGTAAAGATAAATCCGACAAGAACTGCTTCATTCTCTAGAGAATCTGTAAAGCC
ATACAGTACAAGTAGCTCGTGCTGAAAGGTGAATGACTGCCGACAAAACCACAATGCATTCGTGCCTTAATCATTCCTGAGGTGCTGGTGAAATTGCTCC
AGCCCTGTGCACATTCTCGGAGAGGCCCACTTCATCACGTCGGCGTATTTTGTGATTGGAAAAGCTTCACATCTTTTTAGTCTCTGTGGCCGATTCGTAC
TGGGCTTTACCCAGCGTCTTCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTTGCCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGAC
TGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTCC
AGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGCA
GACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAA
CGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGGTCAA
ACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCAGAACCATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCGTTCTCTAGAGGATCTGTAAAG
CAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCT
CAATCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCATATCTTTTTAGTCTCTGTGACCGATTCGT
ACTCGGCTTTGGCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGA
CTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGTC
CAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTGC
AGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTA
ACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCA
AACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATCTGTAAA
GCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTACTGGTGAAATTGC
TCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCG
TACTCGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCG
ACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGTGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTAGT
CCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCCTG
CAGACAGTAAAACGCGTGCATATGCAGAAGGGTGTGTTCCGTCCGAGTGAAGATGAACGCCTTTGCAGAGAACTTCTGTTGATACTTGTTCCGTGCTGTG
TAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGAT
CAAACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGAATCTGTA
AAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATT
GCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTCTGTGATTGAAAAAGCCTCACATCTTTTTAGTCTCTGTGAACAATT
CGTACTCGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAAACTCCAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTG
CGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGTTA
GTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGGCCC
TGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGT
GTAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGA
TCAAACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATCTGT
AAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTAAATGATTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAAT
TGCTCAAGCCCTGTGCACATTACTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGA
TTCGTACTCGGCTTTACCCAGCATCTCCCATTTCCTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGC
TGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAATGT
TAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAACCCAAATCACATTTGGC
CCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCT
GTGTAACGCACGCCAATGGTACCGAGCGAAACTAGTGCCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTC
GATCAAACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTTCATGCTCTAGAGGATCT
GTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAA
TTGCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGA
TTCGTACTCGGCTTTGCCCAGCGTCTTTCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGC
TGCGACTGAATGATTCCTTGGTAGCGCTCACTTTGAAGACAAAACAATTATGCCTTTGCGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAAT
GTTAGTCCAGACTTAGCGAAACGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTG
GCCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGCCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTG
CTGTGTAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTG
TCGATCAAACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACCATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGAT
CTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAGTCATACTCGAGGTGCTGGTG
AAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGAC
CGATTCGTACTAGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATAT
AGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAA
TGTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTT
GGCCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGT
GCTGTGTAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCT
GTCGATCAAACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGA
TCTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTAAATGATTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGT
GAAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGA
CCGATTCGTACTCGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATA
TAGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTA
ATGTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATT
TGGCCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCG
TGCTGTGTAACGCACGCCAATGATACCGAGCGAAACTAGTGTCCTTCCGCCAAGGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATC
TGTCGATCAGACGATGGGCCTAGTACTTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGCACGTAAAGATAATCGCGACGGAAACATGCTCTCTTCTCTA
AGAGGATCTGTAACGCATTACAGTACAAGTAAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGG
TGCTGGTGAAATTGCTCAAGCCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGG
TTCCTGTGACCGATTTCGTACTTAGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGAATAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGC
TGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTT
CAGAAGTTTAATGTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAGCTCCACCAAAAACCA
AATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATA
CTTGTTCCGTGCTGTGTAACGCCCGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTT
CCGGGGATCTGTCGATCAAACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATT
CTCTAGAGGATCTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCG
AGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCCTCACATCTTTTTA
GTCTCTGTGACCAATTCGTACTCGGCTTTACCCAGCGTCTCCCATTCTTGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTCTATCACTCTTGTGCTATGCAATGCTCCTCTCCTCCGCTGAGGTATTTTC
GCTGAGCCCCATTGACCCGCGGTTTCCCTCACGCCCAGACAAAAGGCTGATTTTTTTTTTTCTCTATTGCAATGGGGCGAGCAGTTCAGAAGTTTAATGT
TCGTCCAGACTTGGGCGAAAGCCACTTGCGACACCGGCAGAGTGTTTCCACTGATCCCCTAATTAAGTTCCAAAGCTCCAGCAAAAACCAAATCACATTT
GGCCCTGCCGACAGTAAAACGCCGTGCATATGCGAAGGCTGCTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGT
GCTGTGTAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCT
GTCGATCAAACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGA
TCTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACACATTGCATTCGTGCTTTAATCATACTCGAGGTGCTGGTG
AAATTGCTCAAGCACTGTGCACATTCTCGGAGAAGCCCACCCATCACGTCGGCGTATTTTGTGATTGAAAAGCTTCACATCTTTTTAGTCTCTGTGACCG
ATTCGTACTGGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAG
CTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGTATTGCGATACCAATGTGGCCAGCCGTTCAAAAGTTTAATG
TTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAACCCAAATCACATTTGG
CCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTAATACTTGTTCCGTGC
TGTGTAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGT
CGATCAAACGTTGGACTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGATC
TGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGA
AATTGCTCAATCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACC
GATTCGTACTCGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATA
GCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAAAAGTTTAAT
GTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGATCCAAAGCTCCACCAAAAACCAAATCACATTTG
GCCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTG
CTGTGTAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTG
TCGATCAAACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGAT
CTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTG
AAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGAC
CAATTCGTACTCGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTTGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGATGTAATAT
AGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTAA
TATTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATTGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTT
GGCCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCCTCAGAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTGATACTTGTTCCGT
GCTGTGTAACGCACGCCAATGGTACCGAGCGAAACTAGTGTCCTTCCGCCAAAGAGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCT
GTCGATCAAACGTTGGCCTAGTACTTGCCTAGTAGCAGTCCTGAACAATCGCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAGAGGA
TCTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCCGACAAAACCACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGT
GAAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTCGGCGTATTTTGTGATTGAAAAAGCCTCACATCTTTTTAGTCTCTGTGA
CCAATTCGTACTCGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAGCTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATA
TAGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGTTTA
ATGTTAGTCCAGACTTAGCGAAAGGCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTCCGGCGAGGATTTCGGCATAAACATCTGTACGT
GAGCGCTGGGCCAGAAGATTATGACATTCATTGATCAGAATCCTGAAGATCCAGGTTTTGAAATACTTGGGCTCCTTTAAGCCGGGACACATCTTTTTAG
TCTCTGTGACCGATTCGTACTCGGCTTTACCCAGCATCTCCCATTTCTTGACCACTAGCTCGGATAAAACCTCGAACTGGTCAAACGAGCGCGCTTCGCT
GAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTATGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTC
AGAAGTTTAATGTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCATCGATCCGTAATTAAGCTCCAAAGCTCCACCAAAAACCA
AATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGAGTGAACATGAACGCCATTGGGTAGAGCTTCTGTTGATA
CTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAAGCGAAACTAGGTGTCCTTCCGCCAAAGGGATCATAATAAGTACCATCCCGTCACACCTAAG
CTCTTCCGGGGATCTGTCGATCAAACGTTGGTCTAGGAACTTGCCTAGTAGCAGTCCCTGAATAAATCGCCTGGAACGTAAAGGATAATTTCCGACAGAA
ACTGCTTCAATTCTTCTTAGAGAAATCTGGTAAAGCAATTACAAGTACAAGTTAGCTCGTGCTTGAAAAGTTGATTGACTTGCCGGACAAAACNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTACCGAGCGAAACTAGTGTCCTTCCGCC
AAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTAGCCTAGTACTTGCCTAGTAGCAGTCCTGAATAATC
GCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATTCTCTAAAGGATCTGTAAAGCAATACAGTACAAGTAGCTCGTGTTGAAAGTTGAATGACTG
CCGACAAAACACAATGCATCCGTGCCTTAATCATACTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGT
CGGCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTCGGCTTTACCCAGCATCTCCCTTTTCTTGACCACTAGCT
CGGATAAAACCTCGAACTGGCCAAGCGAGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAAT
TATGCCTTTGGTATTGCGATACCAATGTGGCCAGCAGTTCAGAAAATTAATGTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCC
ATTGATCCCGTAATAAGCTCCAAAGCTCCACCAAAACCCAAATCACATTTGGCCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCA
GAGTGAACATGAACGCCATTGGGTAGAACTTCTGTTAATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAGCGAAACTAGTGCCCTTCCGCC
AAAGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTGGACTAGTACTTGCCTAGTAGCAGTCCTGAATAATC
GCCTGGACGTAAAGATAATTCCGACAGAAACTGCTCCATGCTCTAGAGGATCTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTG
CCGACAAAACACATGCATCCGTGCCTTAATCATGCTCGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGCCACTCCATCACGTCG
GCGTATTTTGTGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCGTACTCGGCTTTACCCAGCGTCTCCCATTTCTTGACCACTAGCTCG
GATAAAACCTCGAACTGGCCAAGCGTGCGCGCTTCGCTGAGGTAATATAGCTGCGACTGAATGATTCCTTGGTAGCGCTCACTTGAAGACAAAACAATTA
TGCCTTTGGCATTGCGATACCAATGTGGCCAGCAGTTCAGAAGCTTAATGTTAGTCCAGACTTGGCGAAAGGCACTTGCGATAGCGGCAGAGTGATCCAT
TGATCCGTAATTAAGCTTCAAAGCTCCACCAAAAACCAAATCACATTTGACCCTGCAGACAGTAAAACGCCGTGCATATGCGAAGGCTGTTTCCGTCAGA
GTGAACATGAACGTCATTGGGTAGAACTTCTGTTGATACTTGTTCCGTGCTGTGTAACGCACGCCAATGGTACCGAGCGAAACTAGTGCCCTTCCGCCAA
AGGGATCATATAAGTACCATCCGTCACACCAAGCTCTTCCGGGGATCTGTCGATCAAACGTTGGACTAGTACTTGCCTAGTAGCAGTCCTGAACATTCGC
CTGGACGTAAAGATAATTCCGACAGAAACTGCTTCATGCTCTAGAGGATCTGTAAAGCAATACAGTACAAGTAGCTCGTGCTGAAAGTTGAATGACTGCC
GACAAAACCACAATGCATCCGTGCCTTAATCATACACGAGGTGCTGGTGAAATTGCTCAAGCCCTGTGCACATTCTCGGAGAGGCCCACTCCATCACGTC
GGCGTATTTTATGATTGAAAAAGCTTCACATCTTTTTAGTCTCTGTGACCGATTCTTCCGCTGCTTGACACTACAGTAGGGAGCATCGCACGCCGATCTG
GCGAATTCCTATATCGAACTTGAAGTATTGTCAAACATTTTTTTGGACCTTGGCCGGAGTCGATGTCCCTTCCGTCTCCCAATCGAATTCGGACTCAGAT
TCTGAGGGAAAAAAAAAAGATGGGGGGGATGACAAACGGAGCCCATCTGAATGTTGTGACGTCTTGACGGCGAGCATGCGCTCTGCGGCTACTAGCTCGA
CCGTAAGCCGGTCAATAGCGAGTGCTGCGCAGGCTAAAGAGACCCCAAGACGCTTGAACGGGCACATCGAAGACAAATTAAAGAGTGAGTTATGCGGAAA
GGCACAGAAAACTCCGTACGATAGGCTTATTTTTTCTAGATTTTAAATTTTCTAAATTTTATCGCCTGGAATAGAGCGCTACTTACGTTAATACTGAAAA
TAACTTCAGATTATAATAGACAGTGCACTTCATAGAGCGCTATCTCCTCTATAACAGAAAACTCCGTCTGGTTAATGTCGTCATACAATGCACAGAGCAA
TACCTGCTCTTTAACTGGAAATAACGTCAGCTTATTATAGTCAACAATACGAAACCACATGTAGCGACCTTAATACTGCAAATATTGTCAGCTTGACAAT
ACAATACAAAAGAGCTCAAATAATTTCATTTTATAGAAAGCATCTGTCGATAATACAAATAAGCCCCTTGAATACAATTGACCCCCTGAATATAAAATAG
CCTTTTTGCTCATAGAAAAAGCTATTCCCCTGTACAAATATCAAATTGCAAGCGAGAAAAATATTGCAATACATTATTGCAACCCAGGTTGCTTCAACAT
GCCTAGGTACTGCGCTGCAGAGCCCCCTGAACAAAAACTGATGATATGAGCTACGAGTGCACTAGCCTAGAACGCATAAGTAGTCTTATAGCAAAGAGAG
CACGATAGCTTTTAAACAGTACTGATCTCGACAAGCCTTTATGTGACGGGGTCACACAGCACCTTGCGCTATCTCCTGAGTAGATCGTGTATCTAAATGA
CTGTAGCTTATCGATCCGATCTCGTGATTGCGTATGCACTCGCTGACGCGCCTTCGTCACTGGCGGTATTCCAACACCCGATCGTCGTAGGAAGCTCACA
GCACAGCTGTTGAACGTCGCACACCGACGCGCCTCTTTTCACCCATCCCCGCTAGGCCATATTCCTCATATCTTCGCGTACGTGCTTGCTTTCCTTGTCC
ACCTCTCACATTTTTAATACGTATAGCTATCTTCCTTTTCATGTTCTGATAAAGACGGTGATTCCTTCGATGCAGCTACTCCTTCCTCCAACGCGTCGTT
ACCACCTGTGGCCAGTGTTATCCCCGTGACGGTGTCGACTGTCGACCTGGCGGACCCCTCGCTGGACCTCCCTCACGTACATGCTTCTTCGCGCGCCCAT
GAGCAGGCTGCCGATCAAGTGGGAGAGCTGCGGGAGCTGCGGCTAAATCACGATATTCTGCGCCGCGAATATCTTGCCGCCTGTTGGCGTGCCGAGGATT
TAGACCGCCAGCTTGCAGTGGGTCACATATCTGCAGCTCGGGAAATAATCGCTCGCCTGGAGAAATGACTTGGTCGAGTGGAGACTTCGCAGAAGCTTAC
TCGCGCCCTTGAGGCCGCCCACGCGGCCTTACGAGAAAAGATGGACAAGCTGACGGTCGACCGAGACGCTCTGCTTCATAAGCTCGACGAGCGGCTTGTG
GCAGTTGCCAGCCTGAGAGAAGATCGGGACCAAGCGCGCGAACGGCTGACAGGCATCGCATCCTTGCTTTCTCCCGGGTCTGCTTCCTCGTCATCGCCCC
CATCTCCTCAAATCCGCAAATGCTCTCGGTTTTTGAGATCTCCGGCTAGAGCAACTCGTTCGCGCAAAGCTGCGCAATCTTCGTTTCGCTCGTCTTCACG
GGGGTTCACGTCGCAACGCCAGCCATCGGCGAATCCGATCGACACGTTGTCCACTGCTGCTGCAAGCCAAGCTGCCGCCTCGGCGTCGTCTGGTTTCTCG
GATAGCAGCGGAGATAATGTTTCGACAACTCTTCTCGATCCCGATCTGCACGTCGGCCGTCTCGCGCCACATTCGATTCTCCGCAACTCGCCCGATCGAC
TTGATCTTCAGGTAAATATGTGGGTGGCGGTCATTCTGACAGCATTTCGTCTCACCTTGCTGCCGCTGGGTTGGATTCCAGAAGCGACAGCGGCAGTTCC
CGCGGCTCAGATCAAGGGTCTGGCACAGATTCTGGAAGTGACGCATCCTCAGAGTCTCCTGATCGTATTCGGGGTTTTGTTGGCTTGCCCAACGTCTTGC
TTTCGGGCACGGAGCTGGCTGCCCTGCTGGTCACTCGTGTACCTCAGATCGACTGGATCCCTGGTTATCGCGATCACCGCCTCTTCCAGGGTCATGCGAT
CGCCCCCTGGACCTCGCTAAACGTACACCAGACGTGTATCTCGGAGATGGACGTGGGCAGCTTGTTCAGCCAATTTTCCAAACCTGTGGAGTGGCTGTTC
CCACTTCGCTGTCCGACACCCCAGCTTCAGGAGTGGAGAGACAATCTGTTTGACGAGGATGGCGTGATTGCCATAATTAAGTCGGCTCCATTGTGACCAG
GGCTAGTCCACTCTGGTTTGATGAGGAGGGGTGGTTTGTGCATATAGCACATCTCAACTTGAACTACAAAGCAAAATACCGCAGGGTTACATACTCATGC
CTTCCCGGTCAGCATCGCCAAGCGTCGCGCTAGTCGGTACCTGGGCGTCTTCTTCATCGGCCGTAAGCAGCGGTGATCCCGGGCAGGAGCCCGGAGAAAT
TCTTTCTCCGGCACATACGGCTCGGTATGATTCGTGGTCTTTGTGATCTTGATCTACTTTAAAATCCGTATTTACTCCATTTTCCTCGCAAAGGTGAGAC
AGGAGCTTGGTATCCAGCGATTTAAGATGGAACTACCCCGGGCAATCTTCTTGGCGCCTTGGCGGTCGCAGACGAGGCTGATCGCTGGCTTAATCACTAC
CGTACCGTGCCAGTCGACCACCACGCACTTGGGATCGCACATCTGCCAGGAAAGTTCATGCCGGCCCTCCCACAGTCGCGTCATCTTTCCAGCGTCAACC
CGTAGTCGTGCTAGTAACCGCGCTGGTGGAGCAGGCCAAGTCCATCCAGCCAATATATGTCCCACTTTGTATCTCCAGATATCTAGAGAGTTTCTTTCGC
TCACATCATTTTCGTTTGGCCTAATCCAACTCCCTGTCGGACCTTCTCCGATTGGTTGCTTCTCGTTTATAGGCCCACAGCACGTTACGAATACCACCTC
CTTCTCGAAGCTAGCAACCACCCTGCAAGTCAATCGACCTCTCGCGTCTCCGCCATGGCCAGCCCACCGCAGATGTTCCACCGCCAACGCATCGTGAGAC
TGCATCGCCCCGAAACGGTTTCGACCGGTCCGTCTACATTCGAAATCTCTCAGCAGTGCTCCGCAATTTAGGTCTGCTTCGTCGATCCGTGAGGGCTCCG
CATATCCCGTCCAGTATACCAGATATTCACGTAAGGCGCGGCCGTAGCGTGTCCGCCGTCCTGTTCTCACATCAGCGATCCGCTCGACTTCGAACTCGCC
TTCGTCTAGATCGCGCTCCCAGCTGTCCTCTGGTAGCAAGCCTCGTCGAAGTCTACGCGGGCGGTCTTATCGTCCGTCGGCGTGGTCCGGATACGTTTTG
GCCAGATTCAGCTTTGTCATATGTACGATCGGGAATAGTCGATATTCAGTGCCGGCAGTCTCTATTCTTGCCGCATGCCGATCGATCATTTCCGCGACTC
TGAAGGGGCCGTGCCACATGTGCGCTAACTTCCTAGCGTAACCTTCTTTGACACGATCTAGGTATAACCACACCTTGTCACCGAACTGGATGTCATGGGG
CCGCACATTCTCGATGTGTCGATCTGCTCTCGCTGTAAAAGCTTCGCGCAGAGCTTCGTTGACCTGTTCTCGGGCCTCTTGGTACTCTCGCTGGGTGTTA
TAGCGCCATCGGAGCGGCTCCTAGTCCTGGCGTCGTGTGCTGCCGAGTGGAAGTGTTGCTTCCAGGGTGGACCTTACGTCCTATCCGTGGATCAGGTAAA
ACGGCGTCGCTCCGCGAATTCGGTCATATGCCGTGCTAATAGCGAAAGTCAAACGCTCCGGGTACTCGTCCCAGTTCTTCTGATCTACATCTGCGACATA
CATCTTCAACGAGCTGGTCAGCGTCTGCACCATCCATTCCGCTGTGCCGTTGTCCTACGAAACGACTGAACGCGCCGAAAAAAATGAGACATGAAACCTG
TCTCCCGATCGTACCGGATAACTTCGCTCGCGCCGAAGCGGCGGAAGACACATTCTTCGTAGCTCTCGGCTATCTTCTGCGCCGTTCTCGACGCACTTAC
CTTGGCTACCACGTAATCTAAAAACAGGTCAACCCAGATGAGCAGCTCGGTATTGCCCTTGTGTGACTTCGGTAGAGACGGGATATGGTCCATCGCGACA
CATTGGAATGGGTACGTACAGTAGCTTGATGTTTCCCAGCGATTCTGCTCGAAGTGTCGGAAGTCCTGTTCCTGTCTCGCAATCCGCACACTGTCTCACA
TAGCGCTGCACACTCTTGAACAGGCCGCGCCAATGGAAGTGCGATCTCACCCGTTGGTACGTTCTTCCAATTCCTTGGTGACCGAATTCCAGGCTTTGAG
GTAATGATGAAGCACGTCTTGTTGTAGATCTTCCGGCACTACCAGTTTCGCTACTTGGTCGCGGTTAACGTCGCCTCCCCGTGCGTTCGGGCAATAGAAG
AGTAGGCCGTCCTCGCCGGCTTGTACTCGTCGGCGATTTGGCTGCAAGTACGCGCCTCTTCAGCGCTTAGCTTCTCCAGATCACCCAACCGGTGCGTTTT
TAGATCCGCGATCCACTTCTCCTCGTTCTGTGCTTTCCGGATTCGATCTGTTCTCATACGTTATACCATACCCAACCGTATCACTTTCGGAGTACTCGCA
AGGCGCGTCCGTAGTCGTGTAGCAGCCGCTACGCATACGGCCTACGGGAGCAACAGTTTCGGCAGCCGGTTGAGATCGATCAGGTCTTCTGAGTTTATGT
CCGAGGTAACTACGGTATCTGCTTGTTCGCGTAGCCCGTCGCTTGCTAGCCGATCTGCACTTTGGTTCCATTATAGCTTTACATGTAGGAATTCGTGTGA
CGGCCACGACCTCAGTCGATCCAGCGCCCGCTGTCGCAGAGACGTCAAGCTGGGTGCCTTGCACTCGATCTCGCCGCGCATCTGCTTGATCACTAGGTTG
GCGTCGCCGCAAATGATCAGCCGTCCCCTGTCTAGGTTTGATAGTTGATTGAACGCCAACAGTAGCCCGTCGTACTCTGCCTCGTTTACCGTGAGGTCTG
GCGCATACTTTGTTTCCGCTGCGACCGCAATCCACTCAGGTAGCTTCCATACAATGGCACTGCTCGCCCGTCCGCCGCTTTTTCCACGCGCCGATCCGTC
AAAACTCACGACTAAAACCTCCTCGCCTTGCTCAACCGTCGTCGGGGTTGCGGCGATATTTGAACGTGGGCGCTTGCTTGGTGCAACCGACGACAAGATC
GAGTCGACGTTCTCCCGAGGGGTGATACTTGCTGCAATGGTGCCCAGAATTTCGTTCTCTCTGCGCGTACACTTGATAGTCTCTAGCGTCCACGGCGAAA
CCAATGCTGCTCAGTTGCCCAGCCGGCCCTGCAAACACAATGATCGCACCAGCCATGCTAGCGTGGAGTATCGCGTCAGCACCCTGCTCGAAAACCCGCC
GTTGACAACCCTAGGACTGATCGATCTCGTGATTAGCGTGGTGTAACACACGTCCAGTATCCTGAGAAGAGCCAAGATCTCCATCTCAACGGTACCGTAG
TTCAACTCATTGGACCTCAACGTGCGACTGGTGAACGTTACAGACATTTACGTGCCGTCGTGTTCCTGCATCAAGACCGCCGAAATCGCCCAATCACTCG
CGAAGACGACGATCACTGGCGTCCGAACGGGGTCAAAGTGTCTGGACACTGGTTCGTCTGCGATCTTGTTCTTCAGCTGTTAGAACGCTAGTCGCGCTCG
GACCAATTTGTCTGTTTCATCCGCCGAGGCGATCCGCTTCTCGCCCTCAGCAGCTCGATCGGGTTTCGGGTTCATTTCGTGAAATTCCACTTCTTGCAGT
TCATACAAGATCGACGCGTAGATTGCGAAATCATCAATGAATCTGCTGTTGTAGTTAAGGCTACCAAGAAAAGTCTGGATAGATCACGGTGCTCACGGGA
ATGGCAAAACCGTCAGAGTCTCGAGGTTCTTCGGGTGCGTTTCGAGGCCGTCCGCGGACACTCGATGTCCCAGGTAGTCTACTTGGCGGCAGCCCCATGA
TCTCTTCACCATGCTGATCGACAAGTTCCAACGGTCGCACGCGTGTAGCAGTCGATCGATTCTGGTGCAGAGCTCGTTCCAGGATTCAGTGGTCACCAGA
ATGCCGTCGATGTACGAGCGACGTCCCAGCACAGGCGGTCCTGAATGTACGTCTGGATCACCGATCTTGAACGCATCCGCCATACCTGACTGGTCGCCTT
CTTCGCGGATCCGAAGATAGCCATACAATGCGTTGTCCAGATGTCGCTGGTAGATTTGAGGGACGTTCTTCAACCCAAAGCGCATACGCAGCCATTCAAA
GAGACCAAACGGCATGACGAACGCCGACACCAAACGCACCCGCTGGGGTCGTCGACATGACCCAGAAACCGCTCGCCATATCTAACGAGCAGTACCAGAG
TGCCTTATCTAGGTCTTCCAACAGATCGTTGATCAACGACATGGCGTACACCATGAGACGTATCAGGCTGTTCACCACGCGGCAATCGATGCGGAGTCTA
ATGTCGACCCCATTCCTCTTGACAATCACCACGATAGGCGACACCCACGGCAAGCTAGACGTCTTTCTGATATGGGCAGACCCTTGATCAAGCCGGATAA
GTTATCTCGAAATTGCGGCGCAACTCGACGCACGCGCTGATCCACTGGCTTGGCGGTCCCAGTATCGATATCACAGTAGACGCCTCGCGCGGCTGGCGGC
AGGGCGTTCCCTTCTCCGAGAAGAAGATGGTGTCGGCTTCAGATGATATTCCCCAACCTAACTTCATCCGCTGGCGCGACAAAGTCCTCATACTCGATTC
GGACGTCTTCAAGCTTCACATTTCCTGGCGTTGTCGTCCCCTCTGGCAAGATTACCAACTGAGCGTCTACGCCTTCGACAAAGCGTTTGCCCCCTTCGTT
TATGCAGACTTGGTCAGCCTCCACAGGGATCGGGCTTGACACATTCCCAACCGGCTTTACTTCCATCTGATTCACGATGAGATCAGCTACTACGTCCACC
CCGCTCCCAGGTTTGCTGACTGGCGTGGTCTGCACATCCTCGAACCTGCCGGTGGCGATTTCGCCGTCCGCCGCTGTCGGCCCATCGATCTGGTCTTCTG
GCGCATACGTTCGCGCGGTCTGCGTTCGAGATACTTTTCTGACCATGACTTCGACCCTCCTGACTTCGGGCGCCTCCGTGATATGGCTGCTGCCGGCCAC
CCGACCTATCGGTCGCCTTAGGATGCCTGTCGGCGTGTCATACTGCGGATGAGATACCATCGGCTCCGTCGACTCCCCGATCCGATTATCTTCCTCGACT
GTCACATCTGTGGTAGCCGGTAATACCAGATGCTACCACTATGCGTATCGACGCGATCCTACGGTGATGAATCCTTGACGTCTTGGTACACCATCGCCTG
GCAGCCTCATTCCTACCGAGGTATTAAGGGAACATACAGGCAGCTATTTCGTATAATTCGAATTGTGGTGCTTTCACCCCCGATAGTGATTCATGCTGCT
GGCTCCAGACAAAAGGCGTTCCGGCGTAAAACGAACGATGTGGCAGTTCGTCCAACGCATCCGCCAAGGTCTTCAACTTGCGCTCAACCGCTATCTTCCA
ACACTACTCCTCGTGGGTGGTGCCGCGGCCCTCCTCATCATGCAGCCCCTGAGTCCGAATTTGGTAAGCCTCGGTCCCGCCAACGTCTCCGTCAATACAT
CCGCTCGCATTCTCTCCGCCTCGCGGTAACTCGGTGCTAGCGCCCTCCCTGCGCGTAGTGCGACACGAAGTTGATCCTCACATCTCCATGCTTAGTCGTG
GACGCCACATCCTCTCCTTCAAGCTGCTTCAGCGCGGCCTGATTGTCCACTCGTAACATCTTCGGTTCTACAAACGCCACCCTCATCTCCTCCAGCAGTT
CCCGCACGCCGAGTAGTTTCTGTCCCATCACAGAGGCGGCTGTGAACTACCTCCATTGTGGAGAGTGACACATCTCCCTGTTGCTTACGGACCGCCATAT
CGTCCGCAGTAGCCAGACCTTCAATGATTTACTTTCTTTTGCAATTGTCGGCAGCGCCGTCCGCGTCACTGTACATCACCACACGAAGCCGCTCATTTCA
CTTTTCACCTCCTTACATACCCAGCCACATTACCTGGGTCCCCGCCAAGTACCTCAAAATCCTTTTGGCGAGTTGTTAATCCACCGTTACATATGTCGAT
GCTTTGTGCACTACAAAAGCAATATCGGGACGCGTACAGCGCGGTACCCACAAAAGGCTGCCTAGGAGAGACTGGAATCTCCTTATAGTCACCGCGGCAT
CACCGCTCACCACGGGCTGTTATTCTTGGTCTCAACCCTAAACTTCATTTCCTCTTCGCCGATTGGGGGTACGGACACCGCGCACCAGCTCCGTCCGTAC
TGCTTGAGCTAAGCTTTTATCGTTACCTCTTGAAACGAAGTTGTATTCTTCTTCTTCGTCGTCGTACATGACACGCATGCCTAAAAACGTGTGCACGCTT
CCAACGTACTTAATAGAAGGCTCCGTAAGCACACCAAAGAAAGCCTCTACAGCATTTTGCGTAGTCCCAGTCACCAGCAGCTCATCTGCGTACACTCTGA
CAACCACCACATCATCTCCGTCGTGCCTGCAGTCGACAAACATGCTCGCAGATTTCTGGTCGAAATTGATGCCCTTCAAGTTCTTGTGCACTAGCTTACT
TCACAGATGACCCACCTGCTTCAGCCCATATAAGGCTTTATTCAACTTCTACTCTAGTTCGTCACCCGGCCCAGCACCCAATGCTTCTCGGACCTCCTCA
CGAATCGTCTTTCCTTGTGGAGCACGCATAAATATGTTCAGACCATCCTCCTTGCCTACCTGAACGTAGGCATTGGAAACGGCGCCATCCTTGGCCGGTA
CGCGCCATTTCTTCGCCATGCCAGAATGAGCTTAGCGCTTGGCATGTCGATCACGGACGTGAACGTCACACTGTAGCTCACACCAAACCTCTGCTTATTG
TTTTAAGCTAAGAGCCTCGCCAAACGTTCGATCGCTCTGTCAGCGTTCCGTTTGGTCTTAAACACCCAATTTGTATCGAGAGCGTGCGATCCGCGCGGCG
GTCGCACGACATTCCATACTCAGTTATTTTCCAACACAGCGATAACTTCGACAATCGCTCAGTTCCATGCCCCGCGCCTCCAGTATTGACGACCCGGAGG
GATCTAAGGTCATGCGTCGCGGCTCGGAGGGCGTGTCTAATCCATCTTCGGCCGCGGATTCGTAGTTGGAGGATGCAGCTTGAGTGACCCTCGGCGACGA
CACTGGATCCATGGTCTGCGGCTTCTCACCGGCGATGTACGTGGTCCTGGCGAAGCGATCCTGCGCCACCGACAGTATGAGGTCCAGATCTAGCTCGAAA
ATACCCTCCGCGTCGAACGCACCGGCCACGATACCAGAATCCGAAAGCAGACGTAATAGATCCTTAACTGTCGCCAATTTGTTCGACGTCTTTGTTGGTG
CCCTCACTGGTTCCCTTGGATCTTCGATCTGTCGTGAATTCAGGACCCGCATCACAGGATCTCGATACAGGAAGACGCGTAAAGCTGGGTGGCGATATAC
AAACGCGCGATATTTGTCGGACCAGCTTGACCTGGATCCAGCTGGATCTTCTTCTTCCGACTATGGAGCTTGCATTATCTTCCGCGCAGTCTTACTCGCA
TCTTTTCGACTAGCCGGCATGGGTTTAGCTACGGTGTTGATTTAGCCGGTGAATCAATAAATGCGTACCGTTTTGCCTTCACTTTCCTTTTATTTGTTAG
CTGATCTTGACTTGCGCCAAAAACAGCAGGGACCTCGAAGGGACCGGGGAAGGAGAGAGAGGGTTTTCTTCTAGATCCGGAACTATCTCCCTTCCGTCGA
CAGAGTTTCTCTCAGGACTCCGTCGATCCGCGGACCTTGTTTCATTCTACGACGTCATCATCTATCCGACCTCCGATGACGCCTCTTCCCCTAGCTCAAT
CTGCACTTGAACATCTTCTTGGGACCCACGGTGAAATTTTAAGTCACCAAAAGATCCAGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTG
CGAGATTGCTGGATCCAACTTACCAACGCGGTGTAGTGATTTCTCCATAATTGTCGGCAGAAAGAGACCTGATCGCCTTCAAGCTGTTTAAGCTATGAAG
ACTCGGTCACCTAATGTACGGTGACTCCAAGGTGCAAGAGACTCGACGGTGTCACTACCGAACACTCAGCGGATGTTGGATACGGTCCAGATGTCAATTA
ATCCAGGCTGTTCTTATTATTAATAATGGACTGGCCGGATTCGCATTCAGCGGCCAATAACTTACCATCTACGATACAAACCCTCGGTGGCGGTTGGAAT
GAGTTTGTGGAAGGCTCCGCGACCCTTTGAAGGCGCGGTCACCGTCTCGGAAAAAGTGCGAGCTGTTAAAGATACTCATGCGACGGTGCAGACGACGCTT
GGCGTGCAAGAAGATCCATAACGGATCATTGTTCACTTGATATTTGTATACTTGATTAGGACTTCTTATTAGGAATAGACCGGAAAGGGTAAACATAAAT
ACAGAACAGAAGTTTTACTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTC
GAAGCTCTGTAGCGAGAATTCATCCGGCAAGGCCAAGCGACTGTGTGTTTTGGCCGATTACTATCGGGAGGTTTTACGTGACGGCTCATTGTTGCCTATT
TGCACGACTTGGAGTGCTTGAATTGCATCCCTTTATTCTTCCAACCAAGTGTTGAACCCTCGGTGCCCTCGTAAAAGGCTTACTCGTGCCTGGTACCCTT
CCGCTGTTGGGATCACGAGGATTTATAACACCTATTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTTACTGGTTGGTCTATATAAGTAATTTACAA
GGTCCAGTCTGTCCCGGTGCAAGGGCAGAACTGGAGTTTCAGGTCCGCCCGAACGATCGTTTGTTGTCCTAGCAGATGTATTGTTGTGGGAGCTTCCTAA
CTACATTTGTAGCTAGAGTTCACGTGGGATTTCCAACACCACAACTGATGCCGCGACACGGGAACAGAGTGTGACCGTTGTGAACTGTTTGTATGGCCTT
CAAGCTTACGAGCTACCACGAGGAGAAGAAGAACAAGAACAAGAAAACGAGAAAAATGGCGAAAGCACAATCGACGGTACCAGCTACTCCTGCCAAGTCT
GGCGGAGCTCGCAGCGAGAGTTCAAGTCCGGACGTGACGGTGGCACGCTTTGGAACAGCCGTCGAGCTTTCGGTGAGTTTCGAGGATGAGGCGGACATCG
GTCCGGACGCCCATGATTACGACGATTACGAAGATAAGACGCTGGCTCCAGAGCCAGGTGCGACGACACCGGAGACGGCCACGCTATCATCGGGGCTGAG
CGGGGCGACCAGGTCCCTTTCGAGGAACGATGCCGACGAGCTAGATGGCGTTGCGGGACCGGAACCGGTCTACGAAGAATATGACGGTGGGACCGGAGGT
TCTAACCCCTCGGTGGCGAGTGCAAAGCGTTCAGCATTGCCGAAGGCACCTCGCCCACCTATCAAGGGTGATACACCAGTCGCCAAGCGCATTTTCGACC
GCGTATAGGCGCTGATACAGAATGATGAGTGGATGTAGCTGTTCAAGCCTATTCTCAAGAGACAGACTGACTGGCCCGCGCTTGCACAAAAACTTTAATA
CCCCATCAGCTCAATTTCGACTAGCCAAGTTGCCGAGGATTCAGTCTTGAGGCTATTCTACCATGTGGGTGATCTTTATCTGGCTAAGGTCGGACGCTTC
TTCACATCCGGCAAATTGAAAGCATCGAGCTGGTGGTCATCATCCCTTCCATAACGTTCTTGAGCCTTTCCCACCCAAAAAACAGCGCTCTTTGTCCATA
TGTAGGTCGCCCAGTCCTGTTCACCCCAACGCTTAGGTATCCCCTCAACCCATTGGCGTGAGTGGCTGTGTCATCTTGCACCAACGCTAGTGCAGCAGAA
ACAACGTAGTACTTGTGCTCAGTACCCTTTTAAAAGATGTCATTTGGTCCGTATGATCACGACCACACACTTAGAAGAGAAAATGACAAGTAAGATTAAA
ATCGTTAACACTGTTTGCCTCAAAGCTCCAACATTCTTCTTAAGCGGATTTGGTCACCTTTTCAAGCTGATACCCACTTTGTCTGACTTCATTATGCATT
GGCGCACTGCTGCGCTTGTCCATATATGTATGGCAAAAGTGAGCTCTAAGGCCCGTTGCTAGCCACGCTAATTTAGTGGATTTGTCAATAGTGGCCCAAT
CAGCGATTTGTAAGTGAACGCCATATGCATCCACTAACTTGGAATCAGATCCCCGTCCACCCGGGTTTTCAAAAGCCAGCGGACGGGGACTCTTTGTGGA
CGGAAGGGAGACCTCCCCACTGGTGAATCTCCATACGGAATGAAGACGTCATAGCCGACGATTGTCGTTGTTATGGCATGAATGGTAAGGTCATTCCTAA
TTTCGCCTCGCTATATATCATCCTGTCTAACGTTGCTACACTCGATA