Description :
Non Conding Region
Location :
Scaffold_1:43597- 43726
Sequence
129 bases(100 bases per row)
CGAGAAGGTACAACTTCAACGGTGTTTTGGCGTGGTGCACATAATTTTGAGTATACTGAGACCAAGTGGTTGAGTTCAGCATCCTCATTTGATTAAATTT
GCACCCAGCCAAAACTCAGAGCAACGCGA