Description :
Non Conding Region
Location :
Scaffold_1:43493- 46617
Sequence
3124 bases(100 bases per row)
GATCTCTTCCACGAAACACATGACTCATCGTTTCTTTCACTATATGGACGATTTGAATCGTATCACACGACGCCTTTTCCGTTTAATGCTGCGAAGTGCA
TGCGCTGCGAGCGTTCAAACGCTTTATTTGGATGAAAACGTGCTTCATGCAGCGTCATGTTGCAGCCTCTTTCGAGCCACTCGACAAAGCGCGCTTCATA
CAATTCCTTGGTCTCATTGGGCGCCAGAGGAaCGAAGATAGGAACGATCGGAATACCGAAATGCTCAACCCTCTCGGCTGCGGTGAAGAGTACGTACTCG
GAGAATCGTCGCGCTTTGAAGTCTCTTCGGTAATGCTCCAGCTCCATGTATCGCTTCAGATATCGCATATGCCGTGCCGAAGCAGGTGTCTCCTTTGCAC
TGCCCATAGATCGCCCATGAGTGCGaTCGTAGCcACAAACGGAaCAGATCcATTCTCCCgtCAACGgACaCAGtCTTtGTATgACTGgAGCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGACAAAGCGCGCTTCGTACTGCTCCTCCGTCTCGCCAGGTGCCAGTGGTACAGCAAtCGGAAC
CATGGGGAAGCCAAATCGCCGCAGCTTcTCGTCTGCCGTCATATGCGCGAGCGAAGCGAACACGCCCGACtCAACCtCTTTCCGAAACTCGTCCAGCGAC
ACCACGCGCTTGGCATTGAGCACGTCACGCGGCAGGGCTTTCGGATCGAAtGTCTTCTAGCTCGAGTCTGAGCTCCCATCCACCACTGGCCCGTGCGTCT
CCGTCTCCTCCACCTCCCCCGTCAGCCGCCGCCTCTCCTCCAAGGaTTTCCCATTGAACTCCTTGACTCTCTGCATCGCGAACGCGCATCGAGCCAGTCG
CTCGCGGTTCGGATTCGCGTCCCGCACGAGCTCTGCGATCGTGATGTTGCGCTCAGCGAGCCACGCGaCGAACTGCGTCTCGTACTGCTGCTCGGTCTCG
CCCGGAGCGAGCGGCACGGCGATGGGCATGATCACCGAACCGAAGCGCTGCAaCCGCTCTGTGCCCGTCAGATCCACGCCATCCGCCACCTCCTTCGCAT
ACACCGCCAGCGGCAATACACGGCGTTGGAGCAGCTCCGTGCGCGAGgCAGGGAGCCGAGAGCGAGCGAGTCGCGGCATCCGGCTGCTGTCATTAAGCAT
GGTGAGCGGAGCCGAACTTAACGTTGTGTGGAACTGCTAAGTACGCACTCCACATGGCTTCGTACGGCGTCCCTTCAAGATGAACCGAGTGACGTCACAT
GCCTACGTCTGTTCATGGCGATTGATGTCCACAATCCAGCAGCACACGTAGACGCAAGCACAGGGAGCTtCcATGCGTCCGGCACTGGCGACGGTCCGAG
GCGCTGGGGCCAGTCCACTCCaCAATCTACTCGCTCTTGCTCAAGCTTCCAaGAaTCCACCGAGgCGACCAaGAAGaGCGCCCGCACGGgCcGGCCTCCT
GCTTCTGCTGCGCTCCCcTTGCTCGCTCTCGTCATGGAGGGCTGGCAGTCGTCGTGGCCCTCAGGCATCCTGGGTGTCGCGTTCATCAACGTGACGACAT
CtCTGATCACGGCCAGCAGCTTCtCAGACCCACaGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCGA
GTGGTCTAGTCACACCAGcccACTCAGCAGGTTCGGCATCGGTTCGTCGGTGGgAgAGAAGTTGGCGTGGATGTGTTGTAGTTGTTCGCGGCTACtATTC
GTCACGAAGACTGAGGAGACGAAAGCGTGGGCTGTGTAACACGATCGCCAACGAGAACGAGATCGTGAACGAGCTCGTGAACGAGATCGTGAACGAGGAC
CAACTCGTCATCATGAGCACTCTCCTCACACCGATACAGCAGAAGGCACATGGTGGCGAGTTGTTCAAGTGTCGATCCTGACGTCGGCTGACCTCAACGG
TGGGTGAATCCCGTCTTGGGTCATCTGGGCCTCGATGAGCGCAGTGAAAGCAGCGACTCTCTGACGTACGCTTGGCGTCTGATGAGGCTGTGCTGGTGGT
ATGTCTTGATCTTGATGGCTGTGCTCTTCGATCTTGATTTTCGTCGCCTGTTCGTGgTCGTGGCCACACTCAAGTCAGGAaGAGGCGCACCTTTTGTTGG
CGTTCCTCAACGCGGCACGTGGTTTCAAGTTGGAAGCCGAGTGGTGTGCTCTTGCGACCGACGCCGAGCTGCAGTTGTTCGCGGCTACAATTTGTCGGCG
AAGATCGAAGAATGCAGTGCGTGGGCTGTGCACCGTAGCGACAACTCGCCATCGTGAGTCTTGTGTTCACCCCACTAGAGCAGAAGGCTCATGGTGTTGA
GTTGCGCAAGTTTGCTCCTTCCCCGATCACGCCTGCCCAGTGACGCGACCTTCGCAAAGAACGCAGAGGGTGTTGAGGTACTGTGATACGAGCTCGGCAT
GGCGTTTGGCATTTACGACACTGGGTCCTGTAGGAAGTCCAAGTCGCAACTTCCTAGGTGAGTCTGTTCGCAAATGCAAACGCCATACCGAGCTCACGCT
CGAGTACCTGAATACGTTCTGCGTGCATGGTGAGGATCACAACACACGCTGAtCGCCAGGGCTTTGACTGAGTGTCGTAGGATGGAGAGGAATGCGTGCA
ATGTGATGTTCAACTGGAGTTGATGCGCTTCCAGCAGTTCCTTTTtCATTTGCCGCTGTAAACTGTTGCTCATTATAGTAGGGCGTCATCAGCGGCAACC
GCTGAACTCGATTGTGTGAACTGAGTGCTGTGAGCAGCACGCGAGAACTCAAGTGCATACATCACACCACACCAATGGACCATCGACTGCAAGTTCATTC
ATAGTAAGACTTCCACTGATATAC