Description :
Non Conding Region
Location :
Scaffold_1:43453- 43751
Sequence
298 bases(100 bases per row)
TAGATGGCCAGTAGACCAAGGCACAACGCAAGCATGGGACTCTTTTGAAAACGCAAAATCGGGTATGGTATATTATCGTGTGTTTTTGTTTTTGTTGTTG
TTTGGTTGTGCTATCTTTCTCAAGGTTCACGCATGAAGATGCATCCGCTCCGGGTACTGCGCATGATACACGCGCAGGCAGAGGCGAAGGCACCGATATA
TAAAGAGAAGCAGTGTGAACCACGAGACGTTGTGCCACGCGTCCAGTCCATCTTCTTGGTAGCGTGCGACTTGCGACGCGAACTCGTCGACGCGCGCT