Description :
Non Conding Region
Location :
scaffold_1:43300- 46050
Sequence
2750 bases(100 bases per row)
CTGCATGTGCTGTCCGCGTGCAGGAACTGGATTTTGGTTGAAGAATTTTTTTCGTCGTCGCTGTTGTGGGCTGCGAGCTCCGCTTTCATGTTTGGAGCGG
CGGTGCTGGTTTTCAGAAATGGATATTCAAACGTCGTCTTCAGGAGTTGAGGGGAGTCGGTGAATAAGGGAAGCTGGACGGCCTTAGACCACCAAGCACG
ACAAGAAGCATTTGCTGCTGCACGTGGTCCATTCTTCTAAAGCTGGCGATGTGGATATTTCCTAGGAACAAAACCTCAGAAAAATGCATGCAATTCTATT
CTCTCACCCACGTGTTGTTGAACTCACAGTCTAGACGACGGGTAGCTGTTCTACTCTCGTTGAAACTGTATCATTTGCAGACCTTGGCCAACAACCACAA
CTTCATCAGTAGTTCTAGTTTGCCGAATAGCGATATCAGCAATATCTGCACATTCCGAGAATGCAGCACCTTGCCACTCTAGCTCGGTACAGTTCTCGTC
GCGACGAATGCTCCATTTGCTAACACGTTGGTCGTACCCGGCTGCGAAAACGACCTCAGCATTCATACATGCAACAGTTTTAATTGCTGAACCACTGGCA
TTTACCACTCGAGCTTCCGACAGCGTTTGGCATGCTGGAAAGCGAAGTTCACGCAAACTCAAATTCTGATCGTCACCACCGCTGATAAGAGTCACGTCCA
GGCTTCCTTCTTCTTTGCTCTTCGTACACGAGACAAGATCGATACAATTCGTGCCCATATCGTGTGCCAAGTAGTTCCCACTTGGTTCCAACTCACTAAT
TAAATCTTGTACCTTCTCCTTCAATACTCCCACATCTTCATTGAATTCAAGGAGTAAAGCAATCTCCTTCAGCAGCGTGCTTAGATCCCACAATGTCACT
AAGCCGTCCGTAGAGCCAACAGCTAATCCAGCAACTTCTGTATCGCCATTACCATCCTGAAAGCCAACACATGACAATATTGGCTTTCTCGAGACCGAGC
GACAGTCACCTAGCTCAAAAAGTTTGCCTCGATTCACGTCCAGCAGCAGCAGTTGGGTCGAGCCCTCGGAATTGGAGGCTGTCACTAGTCGATACGTATC
AGAAGCAGAGGGCACTGCAAACGTAGCAAGTCCGAGAATGCGGTGATCTTGCGCTGCTTCAGCACGTTCCTGGCCGCACACAAGGCGTAGCAGATCACTT
TCTCCACGAACTAGCCACACATTTAACCGCTGCTTGCCGCCGCCTGAGAGAACGATATGCTCCTCGACACCATCGGCGTTCTTGCGCTGGAAAGTTGTTA
GTGCACGAACTGTAGTCGTGTGGGCAATTCCTGTAGCCACACTACCCCAACGCAAACTAGTACTATTCTCTCGGTCGCTGTGGGCACGACGGCGGTGCAG
TTTAAGACTGTTGTCCTCTGCTGCGGTAACCAAACGCTCACTTCCGAGGAAGGCCACGCACGTCGTCATACGACCGTGATGATGATCGTGCAATGAGCAT
CGGGAGAAAAGAGGAGAAGAGGTGGCAGTATTGGGCTTGTTCAAAACAGTTGAGTGTACCTTGATGTCAACATGTTGCTTTTTCGTTGCTGGAGGTGTAA
ACACAAATGTGTGTGAGGGCAAGGCAGAGCATGTTTCACCTGCCGTGGTGAAAAGCGCATGTGGACGGCGCCAACCACCGCAGCCCACGTTGAACACACG
ATATTGAGCAGAGAAGTTGTGCAAAATGGCTTGTGCCGCATGAAAGCCGAATACCATGAGGTCACGCATTGCCTTGTCGTCGGAAGATGAAGTTTGGCTC
CACCAAAGCTGCTTGACGGTGGTAATACCTCGGATGGACTCACGACCCACCAGTTCAGCTGTCAATGCTCCATTTGTATCTTCTTCTAACGCATACCAGC
AAATGTATCCATCGTGGCCTCCAGACAGCATGGCGGAACAGCTTTGAACATCGTCATTATCTTTGGAAAGGAGAAGTGACGCCACTAATTCACGCCCATG
GACACCTTTTAGTACAAGAGTTGGTGATCGCGCCACATTGGGCTGATTATCATTTCCCGCTGAAATGAGTGACCGGTGGAACACGTACACATTACCATGC
CCGTCGCCTCCAACGACATTCCTGGTCTTAGACAATCGGTCTACCACCAGAATTGACGATAACGAACTTTTCGCAGGAATCTTGAATGTTGCCACGAGAT
CGATTGTGATCGCCGGTGATAACAAGTTTTCGCTGGTCTCTGCAATGGTTGGTTTCCATTCAGTGAGGGCACCACTAGCACTGCTGATGTATAGGGCATC
TTCTTGGTCCCACCAAATTTTCATGACCCGTACATTTGCTTGGGTAGTCCACGAGTACAACAAAACTCCCGTCGATGCTTCAACAATACACACGCGGCCC
GCTGTATCGCCAAGCAGCAAGAAGCGTCCAGTAGAATCGATTGTGAAAGTTGACAAACCACCAGTTCGGGTTTGAACGGAAGTGCCGTCAATTGGAGGGA
TAGGAAAGAAGAGTTCTGCTGTAAGTGATGACAGGTCCAGGCGAAAAATCTCGCCGTGCTCCGAGGCAACGAATGCGGTCTTGCCATTGTCCAAAGCACT
GAGAATAATGTTACGCACACTGTGAGACGGTGGAGCACCCTTCTTCTTTTTCGATGCAGTAGATGCTGTCGAAATAGGGACACAAATAGTCTTGCAAGCT
CCCGATGCATCGGACGAGGACAGAAGCTGGTGTGTGATATCCCAGAGTTT