Description :
Non Conding Region
Location :
contig_1:43261- 44677
Sequence
1416 bases(100 bases per row)
TGCTCCATCCGCTGTTGTTGCGGCCTCGCGCACTGAGCCAGTGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGTGCGACCGCG
CCACCGAATCTGTACGCGCTGTATCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGATACACTTTGATCCGTTAACGAATCAAAGGCGCGACTAC
TACATCGGGCTCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCAAAGTTGGAGTG
CCTTTGTTGAAAACTTCAACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAGTTCTCGAAGCGTGGTAAACTTGA
ACGACTGCACCATGGTGCAGTCGGTATTGGACTTCCTTGCGCAGTGCCTTACACTGCTTGTGAGTACTGCTACCCGGAGCAGTACGCATCACCGAGCGGG
ACGTCAACGGGTACACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGGCGTCTTCTAGTGCTGCGGATAATCGCAG
CACTTATCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCA
TTTCCGGAATGTCCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTGGGTC
TGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGGCGGGAAGACGCCCCGGGTTTGGT
CAACCAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCG
CGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGACTCTCTGGCGTCTCGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAG
TCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACG
CGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGAGTA
GCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCAT
CTTGGACAAACCGAAT