Description :
Non Conding Region
Location :
Scaffold_1:43201- 43607
Sequence
406 bases(100 bases per row)
GCAGCCACCGTGGCTTGCATCATATACTGGCAGCTCGATGAGCCACGTAAGACACGGTTGCATCCGACTTGGCTTAGCTGTTGACACACCACTGCTACGC
TGTTGACGCATCACTGCTACTCGCTTGGCAATCTGTCCCTGGAGAGCTGCGAGTGCACCAGCAGGCCACCAACGATCCTTATTGCAGCGGTCAGAGCTTG
GGTGAGACGCTACAGCGGGGCCATCGCGCATGGTGCTCAGGAATCGAGGTGTTGAGAGGCGCTGAACGTCGGCAATGTTCTCGTGCACTGCAGAAGCAGC
CGCCACAAGACGATGAGAGAAGAATACCCGTGATTGGTCGAGCGTGGATAAAGATACGCTCTCGACCAATGAAACGCTGGTATTTCCTTCTTCTTCAATT
TGCGAA