Description :
Non Conding Region
Location :
Scaffold_1:43180- 43969
Sequence
789 bases(100 bases per row)
GCGATACGACGTGTGCGTCTACAGCTCTATGAGCCTATAAGTGCGTGGGGCTGACGAAGCGGAGGGAAGACGGGCGTCGCGTCGTCCGTGGGAGGTGGCA
GCGGCGGTCGCTCGTTCTTCGTTGGCCGCGCAGGTTTCGCAATGCGCTCTATTCCCCCTGCTGCGATTGCGATGCAACGTGGTTGATTGTGACGAAAGAG
AAATGAGGAAGAGAAGGAGTACTGAATGCACCCTGAATAGTAGACTTCAGGGCAGGATATCCCCTGTGAAAAACGATGCGTCTTCATTTCAAGCGGCTTT
GAGAAGTGGGAAGAATCACTGGAGTACACGATATCGAATTTGACAATATTGTTATCTCAAATCGCGGTTGTGATCCGCGAACCTGTTTATAATGAACGTT
ACGAACTAAACCAGACAGGGCAATAGTCAGATCATGGTTGCTGTCCACCTCAACGTCATAAAGAGGTAATTTACACTTACATACAAAACCCAAGTCAACT
GTAGACCTCGTGTTGGAGTAACTCAATTTCACAGCCATATGGCTACATGTTTTGGTTGCTATTTTGAGCAACTCCACGAAAAAGTGCGTTCACGCAGGGT
TGGGGTGATTGGGCAGCGAATCAAAAACAATTGCTATTTTCATGATTGCCAGACATGACAATTGCTATAATGTTCCTGACACATCTCACATGCAAATATT
CATGTGCTGATAGATTAGATAGATGTATGGTGGTGTACCTGAAGCGTGGCACACCTCAGTTGAACGCAATCGGCCAATCAATCTGTCCA