Description :
Non Conding Region
Location :
Scaffold_1:42673- 42787
Sequence
114 bases(100 bases per row)
CTCGGATGTGTCATTTGTCCCGGGTGATGGCTCATCTGCTGCGACTGATGATCGAGCTGCTGCATCTGTTGGAGATGGGACTGCGAGAGCGATCCCCTCT
GGATATGAGAGAGA