Description :
Non Conding Region
Location :
Scaffold_1:42640- 46312
Sequence
3672 bases(100 bases per row)
ACCCCGACCATGTACTCATCGTACTAATTTATGTGGACGATACCCTTGTAGGCTACCGAGATGAGTCAGTCATGCAAAATTTGATGAGCGCGCTACACAC
GAAATACGGAGTCAAGGACCTGGGTGAAGCGCGATGGTTCCTTGGCATTTCCCTGCATTTTGACCACGCACATGGTGTTACCACCCTGAACCAGACAAAG
TTTGCTACCGAGATCACGAAGCGCTTTGGAATGGATGAGTGCCGGCCTCGAAAGACACCGATGGATAGAGGAACGATACTGTACAAGAGCGACAAAGATG
AGGAGGCCGCCGGAGACGTGCCTTACAGACAAGCTGTTGGCGCGCTGTTGTATCTGGCTCGGGTAACCCGACCAGACATAATGTACGCTGTGAACCAAGT
GGCCGCTCATGTCTCCAACCCATCCAAAGCACACTGGACTGTCGTCAAGAACATACTCCGCTACGTTGAAGCCACAAAGACAATGGGACTTACGTACCGA
AGGTCAACTGCTGAGCCACACGTGCGCGTCTACACCGACGCCGACTGGGCCAACAATGAAGAAGATCGTCGCTCCATCTCAGGCGCCGTTGTTCAAGTTT
TCGGCTTGCGCTGTAGCCTGGCAAACCAAGCGCCAGCGTGTCGTGTCCAAGTCCTCCAAGTACATTGCTGCAGACAATGGTGTAGAGGAAGCAAGGTGGA
CAATGTTTTTGGTCACTCGACTGATGAAGCTCAACCAGACGATCCCGATCCCCGCCGTGATTGACAACAAATCAATCATCAAGTGGCTCACCAATGGGAA
AAGTTCAGACGCACAGAAGACCGTGGATTGTAATTTTTCTCGATCAGAGAGGCAGTCGACAACGGTGAACTGAAGCTGACGTACTGCCCAACCAATCTAA
TGTTGGCTGACACCCTCGCCAAGGCTTTACCGACGACCCGATTCCAAGAACTGCGGGAAGCACTGGATGTGCATACGTTCAGCGCTGGCGGGGAAGTGTT
GAGGCATCCAGCTTGAACCCACCCAGATTGAGGTGGACTGAGGTCGAATGAGGACTACTAGATCGGTAGAGATGAGTGGCACCCATTTAAGGCGCATGCT
TTGCTGTGAATGAATCACTTTTCAATTCTCGAACACTTTGAGCGACCGATAAGACACCGACCGCTATCATAATACTGTGAGCATACAACATGTAACTACG
CGTAGATTAAGCCTCAGGTAGCCTTCACAGTGAAAGCTTCACTACTATATAATAAAATTTTGAATATCAATGCAAATTATGATACTGAACCGCAGCTGCT
GACCTTCTTCCCCCCTAAATCGATATAACAGTATGTTTTATGCGCCAATACAATATCAATTACGGCAATATTTATTATTGTTTGTCAAATAATTGTAATA
TTTGTTAGGGCTTCGCAATGATCCCAATACAATATAAAACGGACCTCTGCCGAGGAGGCTTCCCTACGTACGATATCTGGGTAAAACTCGGTTTCAGCCA
CATCACCAGCGCGGCGCAGATAGAGCGGATCAAGAAAACTAACGTCTATAGAATCTACAAGCGTTATGTGAACGCATTGACAACGTTATTTCGACGATGG
GCTTTGGGTATCATCTTCCCAAGCTCGTCTCAAATATGCGTATCCGCCCGCGTCAATTCCCGCTAACCCTATATGAGACTACGGCGAACAAAATGTTACT
AACTCGCCATTGAGAGTTATCGAGATAATCGACTTTAAAGTTGACCAATCAGAATTCGTACCTATCCGGACATCGAAATTTTGAATGTGAAAGTTACTCG
TAGAAAGCGGAAAAGACTTGAATGCGATTGCTTTTAACGAGAGTTTTCTGATAATGTATGCTAAGCAAATTTTGAGAAAGAATTGAAGTCACCATCGTTC
AAAACGTGGTAGGATTTTGACCCTTCCCAAATGGGGATAGTTTTTTCAAGTGCCGACAACTCCTCGAATTTTCAACATTTCGATGCAAACAAGGGCTCAA
AATTCGCACGACAGCGCTCTTCACGATAAAGCCACTAAATCGCGATTCGTACTTAGGTTCGTAAGTAATTTTTTGTTTGCCGCCGTCTCAATAATATGGG
AAAGACTACGCGCTTTTTTGATTTTGCTGGCACTTCCGTGCACTTGCTTGGTTAAAGTTTCAACCTAAAACGGAAGGAACTGTAGCCACATGATATTATA
CATGTAATGCATGTAGGTGGCCACGAAATGGCGGCGCCATCGCTTCTCGTGGCCAGCAGGAGGCCCAGGAGTATCTTTCGCCGGCACGCTCCATGCATTT
GAGACAGCCTCAAACAAAAATATACTAATCAACCAAAGTACGAATCGCGATTTAAGCATACCGCTCGAAAGAGCCATGTTCTGTGCTTCTTTTGAGCTAT
TGAGAGATGAAAAATGTTAAGAACTCGCGGAGTGACGTCGGTCTGAAAAAAATATCTCCATTTTCGGACCCCCCAAATCCCGGATTTTATTTGGGGCTTG
TGAGATCAACATTTCTTCAAAATTTACGTATTGTATATTTCTGGAAAGTCCGTGCTAAAAGTAATAGAAGTATAGTATTTTTCGCTTAATACGAGTGATT
TTAACTTTCAAATTTTCGATGTCTTTTAGGTACGAAATTTGATTGGTCAACTTCAAACGCGATTATCTCGATAACTCTAAATGGTGGCTTAGTATCATTT
TGTTTGAGGCTGTCACAGCATATTACGCTTCTATCCCAGATTGGGGGAGTATCTAAGGACATTTTTAAATTAGAACACCAATAGATAAGTCGTTAACCGA
AACTGTGCCCGTATTTGTTCTTAAAGTCGTACCCAAGAGGCTGAGCGCAGGTCCCATATCCTCTGTTTAGCGACCCGCCCTAGCCCACAGCACTGTCGCA
AGGGAAAACGAAGCCCAATTCCAAAAGTCCATCAACGCAACGAAAGTAAAGCCAGGGACATCGAAAAAGCTGCAGACATCCTCGCCATAAAGGGGCTTCG
GGGTCACCAATGAATACTCGCCTCTTACGAAAGAAGGCTCGTTGAACCTAACGGGAAAAAGAGCCGATAACAGAGGTGTATCAGGATTGAGTCCCCTCCG
ACTCGAAGGTGCCAAGTCACATTGCAATTCGCCTCGCCCGTCCAACTTTCGAAGCAAACCAGCAGCCATGAAGTTCCCGCCATCGGTTTGTCCGTTCCGG
GCGCTGGAGCTCACCGACTCGTAGAAGAACACCACCAAGTCCATTTTTGATGGAATTTCGTCGGAAACAATGGCCAAGTACGAGCGGATGCGGGTACAAG
CCAACGGCATCTCGACCATCGAGCGCTGGAAGCTCATCAACGGAAGAAAAACATCGTCGCCTACCAGGACCGATGCGCCCTCGCAGAGCAGTATGGCTGA
ACTGACTTCGGGGAGTAGAAGACCTCGACGGCCTAGAACGCAGACATGTGGAAGATAAAATCTTACAACGCGTAGGAAACTACTACTACTATGGATAGAA
ATGTACTTGGCGTCGATCACCGTGCGGACGGACCCTCGAAGAGCGACTTCAGATTCTCTTCAACAAACGTTTTTTTTTTGTTTTACTTATCCTATCCTTT
TGGATAGATTCACATAATGACTGTGGTTCGCTATGCATCTCAACACAGGATAAAGCTGCTTGAAAAGTGATA