Description :
Non Conding Region
Location :
Scaffold_1:42441- 42718
Sequence
277 bases(100 bases per row)
GGAATTTGGAAATGCCCCGAGCTTCCCGCATCACCCGAAACAGATGGTGCGTCACCTTTGTCCCGTGATAGGCCAACTTCAAGTGCAATCTGGCGGCGAC
GTGATCGGCTGGATCGCGCTGTGCATCGCGCCGTCGGCGGGTGCGGGCAACAAGCGCTCTCGGAGCTCGATCATGGACACGAGTCTGCCGTGACGCCATT
GAGAGACGACGACGGCAGCGCGGTCGAGTGTGTGGTGTCATAGGCTCCGCCGTCCTCGTGGCTTTGTCGCCCGACGC